RchiOBHm_Chr2g0121361

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
34249284 .. 34249876
593 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49390

Sequence Viewer

Length: 177 bp
ATGGCTCGAACCAAGGTTACCCCTCGCAGGGGCGTCAATCAACGCCGTGTTCTCTCTTTGGAAGAAGAAGGTCGTCAAGCGGCCACTAGAGCTGGGCTTACTCGTCCATGGGACCATCGTCCTATCCGTGAGCGTACCCGCAGTCCCCCTCCTCTGCCTCGTCGCTCTCCCAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.81

Weight (kDa)

12.0

Isoelectric Point (pI)

92.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 80, 139
AcoI YGGCCR 1 cut(s) 81
AcyI GRCGYC 1 cut(s) 33
AfaI GTAC 1 cut(s) 136
AfiI CCNNNNNNNGG 3 cut(s) 27, 28, 29
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
AoxI GGCC 1 cut(s) 81
AspS9I GGNCC 1 cut(s) 112
AvaII GGWCC 1 cut(s) 112
BccI CCATC 1 cut(s) 123
BceAI ACGGC 1 cut(s) 30
BfaI CTAG 1 cut(s) 87
BisI GCNGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 82
Bme18I GGWCC 1 cut(s) 112
BmgT120I GGNCC 1 cut(s) 112
BmiI GGNNCC 1 cut(s) 113
BoxI GACNNNNGTC 1 cut(s) 117
BsaHI GRCGYC 1 cut(s) 33
BsaJI CCNNGG 2 cut(s) 12, 107
Bsc4I CCNNNNNNNGG 3 cut(s) 27, 28, 29
BseDI CCNNGG 2 cut(s) 12, 107
BseLI CCNNNNNNNGG 3 cut(s) 27, 28, 29
BseRI GAGGAG 1 cut(s) 141
BseYI CCCAGC 1 cut(s) 92
BshFI GGCC 1 cut(s) 83
BslFI GGGAC 2 cut(s) 125, 129
BslI CCNNNNNNNGG 3 cut(s) 27, 28, 29
BsmFI GGGAC 2 cut(s) 125, 129
BsnI GGCC 1 cut(s) 83
Bsp19I CCATGG 1 cut(s) 107
BspACI CCGC 2 cut(s) 80, 139
BspANI GGCC 1 cut(s) 83
BspLI GGNNCC 1 cut(s) 113
BssECI CCNNGG 2 cut(s) 12, 107
BssNI GRCGYC 1 cut(s) 33
BssT1I CCWWGG 2 cut(s) 12, 107
BstACI GRCGYC 1 cut(s) 33
BstDSI CCRYGG 1 cut(s) 107
BstEII GGTNACC 1 cut(s) 16
BstMWI GCNNNNNNNGC 1 cut(s) 89
BstPAI GACNNNNGTC 1 cut(s) 117
BstPI GGTNACC 1 cut(s) 16
BsuRI GGCC 1 cut(s) 83
BtgI CCRYGG 1 cut(s) 107
Cfr13I GGNCC 1 cut(s) 112
CseI GACGC 1 cut(s) 22
Csp6I GTAC 1 cut(s) 135
CviAII CATG 1 cut(s) 108
CviJI RGCY 4 cut(s) 5, 83, 92, 97
CviKI_1 RGCY 4 cut(s) 5, 83, 92, 97
CviQI GTAC 1 cut(s) 135
EaeI YGGCCR 1 cut(s) 81
Eco130I CCWWGG 2 cut(s) 12, 107
Eco47I GGWCC 1 cut(s) 112
Eco91I GGTNACC 1 cut(s) 16
EcoO65I GGTNACC 1 cut(s) 16
EcoT14I CCWWGG 2 cut(s) 12, 107
ErhI CCWWGG 2 cut(s) 12, 107
FaeI CATG 1 cut(s) 111
FaiI YATR 1 cut(s) 109
FaqI GGGAC 2 cut(s) 125, 129
FatI CATG 1 cut(s) 107
FauI CCCGC 1 cut(s) 146
Fnu4HI GCNGC 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 81
FspBI CTAG 1 cut(s) 87
GluI GCNGC 1 cut(s) 81
GsaI CCCAGC 1 cut(s) 96
HaeIII GGCC 1 cut(s) 83
HgaI GACGC 1 cut(s) 22
Hin1I GRCGYC 1 cut(s) 33
Hin1II CATG 1 cut(s) 111
Hpy99I CGWCG 1 cut(s) 165
HpyAV CCTTC 1 cut(s) 62
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
Hsp92I GRCGYC 1 cut(s) 33
Hsp92II CATG 1 cut(s) 111
LpnPI CCDG 2 cut(s) 13, 78
MaeI CTAG 1 cut(s) 87
MaeIII GTNAC 1 cut(s) 16
MboII GAAGA 2 cut(s) 74, 77
MnlI CCTC 4 cut(s) 33, 159, 162, 168
MwoI GCNNNNNNNGC 1 cut(s) 89
NcoI CCATGG 1 cut(s) 107
NlaIII CATG 1 cut(s) 111
NlaIV GGNNCC 1 cut(s) 113
PcsI WCGNNNNNNNCGW 1 cut(s) 124
PkrI GCNGC 1 cut(s) 82
PshAI GACNNNNGTC 1 cut(s) 117
PspEI GGTNACC 1 cut(s) 16
PspFI CCCAGC 1 cut(s) 92
PspN4I GGNNCC 1 cut(s) 113
PspPI GGNCC 1 cut(s) 112
PsrI GAACNNNNNNTAC 1 cut(s) 33
RsaI GTAC 1 cut(s) 136
RsaNI GTAC 1 cut(s) 135
SatI GCNGC 1 cut(s) 81
Sau96I GGNCC 1 cut(s) 112
SetI ASST 3 cut(s) 18, 73, 94
SinI GGWCC 1 cut(s) 112
SsiI CCGC 2 cut(s) 80, 139
SspMI CTAG 1 cut(s) 87
StyI CCWWGG 2 cut(s) 12, 107
TaqI TCGA 1 cut(s) 7
TauI GCSGC 1 cut(s) 83
TspGWI ACGGA 1 cut(s) 116
VpaK11BI GGWCC 1 cut(s) 112
XspI CTAG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.