RchiOBHm_Chr4g0413301

Reverse transcriptase-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
37562595 .. 37563300
706 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38383

Sequence Viewer

Length: 357 bp
ATGGATTTTGTTAGCTCACCCTTACATGCTGAGTTGCTTGCCTTGAAGAATGGGCTGGAATTGCTGCAGGCTATGAATATTACTCGTGCCACTATTGAAAGTGATTGTTTGGTTGCTGTGCAGGCTATAAATTCCTTAACCCCAGACCTCTCTCCCTTGGGTGCGTTGATTGTGGATGTTCAAGAGCTGTTAGCTGCCAGTTTGGACATCAAACTCTCCCATGTTCCACGCCAAGCTAACACTGTGGCGCATAGGTTGGCTAGTTATAGCTTTGAATGTAATGTTCATCTTGAATGGTTCTCTATTGCTCCAGAATTCATCCTGGATGCCCTTTTGTATGATTTCAATCGTATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

13.02

Weight (kDa)

4.65

Isoelectric Point (pI)

36.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 5 - 89 2.2e-16 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 130, 314
AgsI TTSAA 6 cut(s) 46, 98, 182, 275, 293, 346
AjnI CCWGG 1 cut(s) 321
AluBI AGCT 5 cut(s) 15, 187, 194, 236, 270
AluI AGCT 5 cut(s) 15, 187, 194, 236, 270
ApeKI GCWGC 2 cut(s) 64, 194
ApoI RAATTY 2 cut(s) 130, 314
AspLEI GCGC 1 cut(s) 250
AsuHPI GGTGA 1 cut(s) 9
BauI CACGAG 1 cut(s) 84
BbvI GCAGC 2 cut(s) 51, 181
BciT130I CCWGG 1 cut(s) 323
BfaI CTAG 1 cut(s) 261
BfmI CTRYAG 1 cut(s) 65
BisI GCNGC 2 cut(s) 65, 195
BlsI GCNGC 2 cut(s) 66, 196
Bme1390I CCNGG 1 cut(s) 323
BmrFI CCNGG 1 cut(s) 323
BmsI GCATC 1 cut(s) 316
BpmI CTGGAG 1 cut(s) 294
BsaBI GATNNNNATC 1 cut(s) 345
BsaJI CCNNGG 1 cut(s) 156
Bse1I ACTGG 1 cut(s) 198
Bse8I GATNNNNATC 1 cut(s) 345
BseBI CCWGG 1 cut(s) 323
BseDI CCNNGG 1 cut(s) 156
BseGI GGATG 3 cut(s) 181, 318, 331
BseJI GATNNNNATC 1 cut(s) 345
BseMII CTCAG 1 cut(s) 21
BseNI ACTGG 1 cut(s) 198
BseXI GCAGC 2 cut(s) 51, 181
BsgI GTGCAG 1 cut(s) 140
BspCNI CTCAG 1 cut(s) 22
BspMAI CTGCAG 1 cut(s) 69
BsrI ACTGG 1 cut(s) 198
BssECI CCNNGG 1 cut(s) 156
BssSI CACGAG 1 cut(s) 84
BssT1I CCWWGG 1 cut(s) 156
Bst2BI CACGAG 1 cut(s) 84
Bst2UI CCWGG 1 cut(s) 323
Bst4CI ACNGT 1 cut(s) 244
BstC8I GCNNGC 3 cut(s) 39, 69, 123
BstDEI CTNAG 1 cut(s) 30
BstF5I GGATG 3 cut(s) 181, 318, 331
BstHHI GCGC 1 cut(s) 250
BstMWI GCNNNNNNNGC 2 cut(s) 61, 122
BstNI CCWGG 1 cut(s) 323
BstNSI RCATGY 1 cut(s) 29
BstSCI CCNGG 1 cut(s) 321
BstSFI CTRYAG 1 cut(s) 65
BstV1I GCAGC 2 cut(s) 51, 181
BtsCI GGATG 3 cut(s) 181, 318, 331
BtsIMutI CAGTG 1 cut(s) 240
Cac8I GCNNGC 3 cut(s) 39, 69, 123
CfoI GCGC 1 cut(s) 250
CviAII CATG 2 cut(s) 26, 221
CviJI RGCY 9 cut(s) 15, 55, 71, 125, 187, 194, 236, 260, 270
CviKI_1 RGCY 9 cut(s) 15, 55, 71, 125, 187, 194, 236, 260, 270
DdeI CTNAG 1 cut(s) 30
Eco130I CCWWGG 1 cut(s) 156
EcoRI GAATTC 1 cut(s) 314
EcoRII CCWGG 1 cut(s) 321
EcoT14I CCWWGG 1 cut(s) 156
ErhI CCWWGG 1 cut(s) 156
FaeI CATG 2 cut(s) 29, 224
FaiI YATR 7 cut(s) 27, 74, 128, 222, 252, 267, 339
FatI CATG 2 cut(s) 25, 220
Fnu4HI GCNGC 2 cut(s) 65, 195
FokI GGATG 3 cut(s) 188, 305, 338
Fsp4HI GCNGC 2 cut(s) 65, 195
FspBI CTAG 1 cut(s) 261
GlaI GCGC 1 cut(s) 249
GluI GCNGC 2 cut(s) 65, 195
GsuI CTGGAG 1 cut(s) 294
HhaI GCGC 1 cut(s) 250
Hin1II CATG 2 cut(s) 29, 224
Hin6I GCGC 1 cut(s) 248
HinP1I GCGC 1 cut(s) 248
HphI GGTGA 1 cut(s) 9
Hpy188III TCNNGA 3 cut(s) 182, 290, 311
HpyCH4III ACNGT 1 cut(s) 244
HpyCH4V TGCA 2 cut(s) 67, 121
HpyF10VI GCNNNNNNNGC 2 cut(s) 61, 122
HpyF3I CTNAG 1 cut(s) 30
Hsp92II CATG 2 cut(s) 29, 224
HspAI GCGC 1 cut(s) 248
LmnI GCTCC 1 cut(s) 313
LpnPI CCDG 8 cut(s) 41, 53, 107, 156, 211, 308, 324, 335
Lsp1109I GCAGC 2 cut(s) 51, 181
LweI GCATC 1 cut(s) 316
MaeI CTAG 1 cut(s) 261
MboII GAAGA 1 cut(s) 58
MluCI AATT 3 cut(s) 59, 130, 314
MnlI CCTC 1 cut(s) 158
MseI TTAA 1 cut(s) 137
MspR9I CCNGG 1 cut(s) 323
MvaI CCWGG 1 cut(s) 323
MwoI GCNNNNNNNGC 2 cut(s) 61, 122
NlaIII CATG 2 cut(s) 29, 224
NspI RCATGY 1 cut(s) 29
PfoI TCCNGGA 1 cut(s) 321
PkrI GCNGC 2 cut(s) 66, 196
Psp6I CCWGG 1 cut(s) 321
PspGI CCWGG 1 cut(s) 321
PstI CTGCAG 1 cut(s) 69
SaqAI TTAA 1 cut(s) 137
SatI GCNGC 2 cut(s) 65, 195
ScrFI CCNGG 1 cut(s) 323
SetI ASST 7 cut(s) 17, 150, 189, 196, 238, 257, 272
SfaNI GCATC 1 cut(s) 316
SfcI CTRYAG 1 cut(s) 65
Sse9I AATT 3 cut(s) 59, 130, 314
SspI AATATT 1 cut(s) 79
SspMI CTAG 1 cut(s) 261
StyD4I CCNGG 1 cut(s) 321
StyI CCWWGG 1 cut(s) 156
TaaI ACNGT 1 cut(s) 244
TasI AATT 3 cut(s) 59, 130, 314
Tru1I TTAA 1 cut(s) 137
Tru9I TTAA 1 cut(s) 137
TscAI CASTG 1 cut(s) 247
TseI GCWGC 2 cut(s) 64, 194
TspDTI ATGAA 3 cut(s) 89, 275, 307
TspRI CASTG 1 cut(s) 247
XapI RAATTY 2 cut(s) 130, 314
XceI RCATGY 1 cut(s) 29
XspI CTAG 1 cut(s) 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.