RchiOBHm_Chr4g0438481

Glucan endo-1,3-beta-glucosidase-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0007655
Physical Location & Seq
Reverse (-)
61167440 .. 61169479
2040 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ40661

Sequence Viewer

Length: 576 bp
ATGGCTGCTTTAGTATATATAGTGCTTTTCTTGGCCCTCACTGGGCATTCAAGTGCTACTTATTGCATTTGTAAAGATGGGGTTGGTGATGCTACTCTTCAGAAGGCACTGGACTATGCTTGTGGAGCGGGAGCTGACTGTACACCAATACTTCAAAACGGTGCGTGTTACAACCCCAACACAGTCAAAGACCACTGCAACTGGGCAGTTAATAGCTATTTCCAGAAGAAGGGGCAAACCCAAATGAGCTGTGACTTTGCAGGAGCTGCCACTATTAGCCAAACTCCTCCAAGTACCACGAGTTCCACTTGTGTTTATCCTGCAAGTGGCAGTACTTCCACCACAAACTCAAGCACCACTACTCCAAGCACAACACCAAGCACAACTCCAACCACAGGCACAACCCCAACCACAACTCCAACCACAGGCACAACAACCCCCAGTACAACTCCCTCAGTCTTTGGAATAAGTCCAACAGGGAGTTCACTCACTGATTCAAGCCCTGATATGGCTCCTCACTTCATCACAGCAGCAGCAGCTTTCTCCTTTTCAGTGTTTTTGTTGCTGTGGGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
X8

Protein Analysis

191

Amino Acids

19.52

Weight (kDa)

5.25

Isoelectric Point (pI)

36.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
X8 PF07983 21 - 91 1.2e-21 X8 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 128
AciI CCGC 1 cut(s) 128
AcuI CTGAAG 1 cut(s) 83
AfaI GTAC 4 cut(s) 142, 295, 334, 445
AfiI CCNNNNNNNGG 6 cut(s) 42, 229, 326, 395, 425, 508
AgsI TTSAA 3 cut(s) 51, 155, 498
AjuI GAANNNNNNNTTGG 2 cut(s) 466, 498
AluBI AGCT 5 cut(s) 134, 216, 249, 266, 539
AluI AGCT 5 cut(s) 134, 216, 249, 266, 539
AlwNI CAGNNNCTG 1 cut(s) 266
AoxI GGCC 1 cut(s) 33
ApeKI GCWGC 5 cut(s) 5, 266, 530, 533, 536
AspS9I GGNCC 1 cut(s) 34
AsuHPI GGTGA 1 cut(s) 98
BauI CACGAG 1 cut(s) 298
BbvI GCAGC 4 cut(s) 253, 542, 545, 548
BccI CCATC 1 cut(s) 71
BisI GCNGC 5 cut(s) 6, 267, 531, 534, 537
BlsI GCNGC 5 cut(s) 7, 268, 532, 535, 538
BmcAI AGTACT 1 cut(s) 334
BmgT120I GGNCC 1 cut(s) 34
BmiI GGNNCC 1 cut(s) 513
BmrI ACTGGG 3 cut(s) 51, 211, 435
BmsI GCATC 1 cut(s) 79
BmuI ACTGGG 3 cut(s) 51, 211, 435
BpuEI CTTGAG 1 cut(s) 334
BsaXI ACNNNNNCTCC 4 cut(s) 346, 376, 400, 430
Bsc4I CCNNNNNNNGG 6 cut(s) 42, 229, 326, 395, 425, 508
Bse1I ACTGG 4 cut(s) 46, 114, 206, 441
BseLI CCNNNNNNNGG 6 cut(s) 42, 229, 326, 395, 425, 508
BseMII CTCAG 1 cut(s) 468
BseNI ACTGG 4 cut(s) 46, 114, 206, 441
BseRI GAGGAG 2 cut(s) 276, 504
BseXI GCAGC 4 cut(s) 253, 542, 545, 548
BshFI GGCC 1 cut(s) 35
BslI CCNNNNNNNGG 6 cut(s) 42, 229, 326, 395, 425, 508
BsmI GAATGC 1 cut(s) 46
BsnI GGCC 1 cut(s) 35
Bsp1407I TGTACA 1 cut(s) 140
BspACI CCGC 1 cut(s) 128
BspANI GGCC 1 cut(s) 35
BspCNI CTCAG 1 cut(s) 467
BspLI GGNNCC 1 cut(s) 513
BsrBI CCGCTC 1 cut(s) 128
BsrGI TGTACA 1 cut(s) 140
BsrI ACTGG 4 cut(s) 46, 114, 206, 441
BssSI CACGAG 1 cut(s) 298
Bst2BI CACGAG 1 cut(s) 298
Bst4CI ACNGT 3 cut(s) 140, 161, 184
Bst6I CTCTTC 1 cut(s) 102
BstAPI GCANNNNNTGC 1 cut(s) 266
BstAUI TGTACA 1 cut(s) 140
BstDEI CTNAG 1 cut(s) 454
BstMWI GCNNNNNNNGC 3 cut(s) 125, 266, 536
BstV1I GCAGC 4 cut(s) 253, 542, 545, 548
BsuRI GGCC 1 cut(s) 35
BtsI GCAGTG 1 cut(s) 193
BtsIMutI CAGTG 5 cut(s) 39, 107, 193, 489, 558
CaiI CAGNNNCTG 1 cut(s) 266
Cfr13I GGNCC 1 cut(s) 34
Csp6I GTAC 4 cut(s) 141, 294, 333, 444
CviQI GTAC 4 cut(s) 141, 294, 333, 444
DdeI CTNAG 1 cut(s) 454
Eam1104I CTCTTC 1 cut(s) 102
EarI CTCTTC 1 cut(s) 102
Eco57I CTGAAG 1 cut(s) 83
FaiI YATR 5 cut(s) 16, 18, 20, 117, 509
FalI AAGNNNNNCTT 2 cut(s) 43, 75
FauI CCCGC 1 cut(s) 121
Fnu4HI GCNGC 5 cut(s) 6, 267, 531, 534, 537
Fsp4HI GCNGC 5 cut(s) 6, 267, 531, 534, 537
GluI GCNGC 5 cut(s) 6, 267, 531, 534, 537
HaeIII GGCC 1 cut(s) 35
HinfI GANTC 1 cut(s) 494
HphI GGTGA 1 cut(s) 98
Hpy166II GTNNAC 2 cut(s) 143, 485
Hpy188I TCNGA 1 cut(s) 102
Hpy188III TCNNGA 1 cut(s) 223
Hpy8I GTNNAC 2 cut(s) 143, 485
HpyAV CCTTC 2 cut(s) 97, 223
HpyCH4III ACNGT 3 cut(s) 140, 161, 184
HpyCH4V TGCA 4 cut(s) 66, 198, 260, 323
HpyF10VI GCNNNNNNNGC 3 cut(s) 125, 266, 536
HpyF3I CTNAG 1 cut(s) 454
LmnI GCTCC 4 cut(s) 125, 131, 263, 517
Lsp1109I GCAGC 4 cut(s) 253, 542, 545, 548
LweI GCATC 1 cut(s) 79
MaeIII GTNAC 2 cut(s) 167, 251
MbiI CCGCTC 1 cut(s) 128
MboII GAAGA 2 cut(s) 89, 238
MmeI TCCRAC 3 cut(s) 413, 443, 497
MnlI CCTC 4 cut(s) 47, 297, 463, 525
MseI TTAA 1 cut(s) 210
MslI CAYNNNNRTG 1 cut(s) 51
Mva1269I GAATGC 1 cut(s) 46
MwoI GCNNNNNNNGC 3 cut(s) 125, 266, 536
NlaIV GGNNCC 1 cut(s) 513
NmuCI GTSAC 1 cut(s) 251
PctI GAATGC 1 cut(s) 46
PfeI GAWTC 1 cut(s) 494
PkrI GCNGC 5 cut(s) 7, 268, 532, 535, 538
PspN4I GGNNCC 1 cut(s) 513
PspPI GGNCC 1 cut(s) 34
PsrI GAACNNNNNNTAC 2 cut(s) 286, 318
PstNI CAGNNNCTG 1 cut(s) 266
RsaI GTAC 4 cut(s) 142, 295, 334, 445
RsaNI GTAC 4 cut(s) 141, 294, 333, 444
RseI CAYNNNNRTG 1 cut(s) 51
SaqAI TTAA 1 cut(s) 210
SatI GCNGC 5 cut(s) 6, 267, 531, 534, 537
Sau96I GGNCC 1 cut(s) 34
ScaI AGTACT 1 cut(s) 334
SetI ASST 5 cut(s) 136, 218, 251, 268, 541
SfaNI GCATC 1 cut(s) 79
SmiMI CAYNNNNRTG 1 cut(s) 51
SmlI CTYRAG 1 cut(s) 349
SmoI CTYRAG 1 cut(s) 349
SsiI CCGC 1 cut(s) 128
TaaI ACNGT 3 cut(s) 140, 161, 184
TatI WGTACW 3 cut(s) 140, 332, 443
TfiI GAWTC 1 cut(s) 494
Tru1I TTAA 1 cut(s) 210
Tru9I TTAA 1 cut(s) 210
TscAI CASTG 5 cut(s) 46, 114, 200, 496, 558
TseFI GTSAC 1 cut(s) 251
TseI GCWGC 5 cut(s) 5, 266, 530, 533, 536
Tsp45I GTSAC 1 cut(s) 251
TspDTI ATGAA 1 cut(s) 511
TspRI CASTG 5 cut(s) 46, 114, 200, 496, 558
ZrmI AGTACT 1 cut(s) 334
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.