Rw0G006580

Glucan endo-1,3-beta-glucosidase-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig00245
OG0007655
Physical Location & Seq
Reverse (-)
229726 .. 231247
1522 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G006580.1

Sequence Viewer

Length: 564 bp
ATGGCTGCTTTAGTATATATAGTGCTTTTCTTGGCCCTCACTGGGCATTCAAGTGCTACTTATTGCATATGTAAAGATGGGGTTGGTGATGCTACTCTTCAGAAGGCACTGGACTATGCTTGTGGAGCGGGAGCTGACTGTACACCAATCCTTCAAAACGGTGCGTGTTACAACCCCAACACAGTCAAAGACCACTGCAACTGGGCTGTTAATAGCTATTTCCAGAAGAAGGGTCAAACCCAAATGAGCTGTGACTTTGCAGGAGCTGCCACTACTAGCCAAACTCCTCCAAGTACCACGAGTTCCACTTGTGTTTATCCTGCAAGTGGCAGTACTTCCACCACAAACTCAAGCACCACTACTCCAAGCACAACACCAAGCACAACTCCAACCACAGGCACAACGCCAACCACAGGCACAACAACCCCCAGTACAACTCCCTCAGTCTTTGGAATAAGTCCAACAGCGAGTTCGTTCACTGATTCAAGCCCTGATATGGCTCCTCACTTCATCGCAGCAGCAGCAGCTTTCTCCTTTTCAGTGTTTTTGTTGCTGTGGGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
X8

Protein Analysis

187

Amino Acids

19.18

Weight (kDa)

4.96

Isoelectric Point (pI)

37.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
X8 PF07983 21 - 91 1.2e-21 X8 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 128
AciI CCGC 1 cut(s) 128
AcuI CTGAAG 1 cut(s) 83
AfaI GTAC 4 cut(s) 142, 295, 334, 433
AfiI CCNNNNNNNGG 6 cut(s) 42, 229, 326, 395, 413, 496
AgsI TTSAA 3 cut(s) 51, 155, 486
AjuI GAANNNNNNNTTGG 2 cut(s) 454, 486
AluBI AGCT 5 cut(s) 134, 216, 249, 266, 527
AluI AGCT 5 cut(s) 134, 216, 249, 266, 527
AlwNI CAGNNNCTG 1 cut(s) 266
AoxI GGCC 1 cut(s) 33
ApeKI GCWGC 6 cut(s) 5, 266, 515, 518, 521, 524
AspS9I GGNCC 1 cut(s) 34
AsuHPI GGTGA 1 cut(s) 98
BauI CACGAG 1 cut(s) 298
BbvI GCAGC 5 cut(s) 253, 527, 530, 533, 536
BccI CCATC 1 cut(s) 71
BfaI CTAG 1 cut(s) 276
BisI GCNGC 6 cut(s) 6, 267, 516, 519, 522, 525
BlsI GCNGC 6 cut(s) 7, 268, 517, 520, 523, 526
BmcAI AGTACT 1 cut(s) 334
BmgT120I GGNCC 1 cut(s) 34
BmiI GGNNCC 1 cut(s) 501
BmrI ACTGGG 3 cut(s) 51, 211, 423
BmsI GCATC 1 cut(s) 79
BmuI ACTGGG 3 cut(s) 51, 211, 423
BpuEI CTTGAG 1 cut(s) 334
BsaXI ACNNNNNCTCC 2 cut(s) 346, 376
Bsc4I CCNNNNNNNGG 6 cut(s) 42, 229, 326, 395, 413, 496
Bse1I ACTGG 4 cut(s) 46, 114, 206, 429
BseLI CCNNNNNNNGG 6 cut(s) 42, 229, 326, 395, 413, 496
BseMII CTCAG 1 cut(s) 456
BseNI ACTGG 4 cut(s) 46, 114, 206, 429
BseRI GAGGAG 2 cut(s) 276, 492
BseXI GCAGC 5 cut(s) 253, 527, 530, 533, 536
BshFI GGCC 1 cut(s) 35
BslI CCNNNNNNNGG 6 cut(s) 42, 229, 326, 395, 413, 496
BsmI GAATGC 1 cut(s) 46
BsnI GGCC 1 cut(s) 35
Bsp1407I TGTACA 1 cut(s) 140
BspACI CCGC 1 cut(s) 128
BspANI GGCC 1 cut(s) 35
BspCNI CTCAG 1 cut(s) 455
BspLI GGNNCC 1 cut(s) 501
BsrBI CCGCTC 1 cut(s) 128
BsrGI TGTACA 1 cut(s) 140
BsrI ACTGG 4 cut(s) 46, 114, 206, 429
BssSI CACGAG 1 cut(s) 298
Bst2BI CACGAG 1 cut(s) 298
Bst4CI ACNGT 3 cut(s) 140, 161, 184
Bst6I CTCTTC 1 cut(s) 102
BstAPI GCANNNNNTGC 1 cut(s) 266
BstAUI TGTACA 1 cut(s) 140
BstDEI CTNAG 1 cut(s) 442
BstMWI GCNNNNNNNGC 4 cut(s) 125, 266, 521, 524
BstV1I GCAGC 5 cut(s) 253, 527, 530, 533, 536
BsuRI GGCC 1 cut(s) 35
BtgZI GCGATG 1 cut(s) 496
BtsI GCAGTG 1 cut(s) 193
BtsIMutI CAGTG 5 cut(s) 39, 107, 193, 477, 546
CaiI CAGNNNCTG 1 cut(s) 266
Cfr13I GGNCC 1 cut(s) 34
Csp6I GTAC 4 cut(s) 141, 294, 333, 432
CviQI GTAC 4 cut(s) 141, 294, 333, 432
DdeI CTNAG 1 cut(s) 442
Eam1104I CTCTTC 1 cut(s) 102
EarI CTCTTC 1 cut(s) 102
Eco57I CTGAAG 1 cut(s) 83
FaiI YATR 7 cut(s) 16, 18, 20, 68, 70, 117, 497
FalI AAGNNNNNCTT 2 cut(s) 43, 75
FauI CCCGC 1 cut(s) 121
FauNDI CATATG 1 cut(s) 68
Fnu4HI GCNGC 6 cut(s) 6, 267, 516, 519, 522, 525
Fsp4HI GCNGC 6 cut(s) 6, 267, 516, 519, 522, 525
FspBI CTAG 1 cut(s) 276
GluI GCNGC 6 cut(s) 6, 267, 516, 519, 522, 525
HaeIII GGCC 1 cut(s) 35
HinfI GANTC 1 cut(s) 482
HphI GGTGA 1 cut(s) 98
Hpy166II GTNNAC 2 cut(s) 143, 477
Hpy188I TCNGA 1 cut(s) 102
Hpy188III TCNNGA 1 cut(s) 223
Hpy8I GTNNAC 2 cut(s) 143, 477
HpyAV CCTTC 3 cut(s) 97, 161, 223
HpyCH4III ACNGT 3 cut(s) 140, 161, 184
HpyCH4V TGCA 4 cut(s) 66, 198, 260, 323
HpyF10VI GCNNNNNNNGC 4 cut(s) 125, 266, 521, 524
HpyF3I CTNAG 1 cut(s) 442
LmnI GCTCC 4 cut(s) 125, 131, 263, 505
Lsp1109I GCAGC 5 cut(s) 253, 527, 530, 533, 536
LweI GCATC 1 cut(s) 79
MaeI CTAG 1 cut(s) 276
MaeIII GTNAC 2 cut(s) 167, 251
MbiI CCGCTC 1 cut(s) 128
MboII GAAGA 2 cut(s) 89, 238
MmeI TCCRAC 2 cut(s) 413, 485
MnlI CCTC 4 cut(s) 47, 297, 451, 513
MseI TTAA 1 cut(s) 210
MslI CAYNNNNRTG 1 cut(s) 51
Mva1269I GAATGC 1 cut(s) 46
MwoI GCNNNNNNNGC 4 cut(s) 125, 266, 521, 524
NdeI CATATG 1 cut(s) 68
NlaIV GGNNCC 1 cut(s) 501
NmuCI GTSAC 1 cut(s) 251
PctI GAATGC 1 cut(s) 46
PfeI GAWTC 1 cut(s) 482
PkrI GCNGC 6 cut(s) 7, 268, 517, 520, 523, 526
PspN4I GGNNCC 1 cut(s) 501
PspPI GGNCC 1 cut(s) 34
PsrI GAACNNNNNNTAC 2 cut(s) 286, 318
PstNI CAGNNNCTG 1 cut(s) 266
RsaI GTAC 4 cut(s) 142, 295, 334, 433
RsaNI GTAC 4 cut(s) 141, 294, 333, 432
RseI CAYNNNNRTG 1 cut(s) 51
SaqAI TTAA 1 cut(s) 210
SatI GCNGC 6 cut(s) 6, 267, 516, 519, 522, 525
Sau96I GGNCC 1 cut(s) 34
ScaI AGTACT 1 cut(s) 334
SetI ASST 5 cut(s) 136, 218, 251, 268, 529
SfaNI GCATC 1 cut(s) 79
SmiMI CAYNNNNRTG 1 cut(s) 51
SmlI CTYRAG 1 cut(s) 349
SmoI CTYRAG 1 cut(s) 349
SsiI CCGC 1 cut(s) 128
SspMI CTAG 1 cut(s) 276
TaaI ACNGT 3 cut(s) 140, 161, 184
TatI WGTACW 3 cut(s) 140, 332, 431
TfiI GAWTC 1 cut(s) 482
Tru1I TTAA 1 cut(s) 210
Tru9I TTAA 1 cut(s) 210
TscAI CASTG 5 cut(s) 46, 114, 200, 484, 546
TseFI GTSAC 1 cut(s) 251
TseI GCWGC 6 cut(s) 5, 266, 515, 518, 521, 524
Tsp45I GTSAC 1 cut(s) 251
TspDTI ATGAA 1 cut(s) 499
TspRI CASTG 5 cut(s) 46, 114, 200, 484, 546
XspI CTAG 1 cut(s) 276
ZrmI AGTACT 1 cut(s) 334
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.