RchiOBHm_Chr5g0073961

ABC transporter B family member 25

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
80020331 .. 80020705
375 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34881

Sequence Viewer

Length: 255 bp
ATGAGTGTCTTTTTGGTTTTGCTAGTACCTCGTACTCTTGTGTCTTTCCGAATCAAGTCTCAGATAATAGTTCTGGACAATGGGCAAGTGGTTGAGCAGGGACCCCATGATGTTCTCTTGTCCAAGGCAGGAAGATATGCACAGCTCTGGGGACAGCAAAATAACACAATTGATGCACTTGATGCCACAATTGATACAAATGAGGTGAATGAACTACTCTTTAGAAGCATCATTCTAATTGCAATTGAGTACTAA

Protein Analysis

84

Amino Acids

9.44

Weight (kDa)

4.79

Isoelectric Point (pI)

30.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 3 cut(s) 27, 34, 251
AluBI AGCT 1 cut(s) 145
AluI AGCT 1 cut(s) 145
Alw26I GTCTC 1 cut(s) 63
AspS9I GGNCC 1 cut(s) 101
AsuHPI GGTGA 1 cut(s) 217
AvaII GGWCC 1 cut(s) 101
BcoDI GTCTC 1 cut(s) 63
BfaI CTAG 1 cut(s) 23
BmcAI AGTACT 1 cut(s) 251
Bme18I GGWCC 1 cut(s) 101
BmgT120I GGNCC 1 cut(s) 101
BmiI GGNNCC 2 cut(s) 102, 103
BmsI GCATC 3 cut(s) 163, 172, 237
BsaJI CCNNGG 1 cut(s) 123
BseDI CCNNGG 1 cut(s) 123
BseMII CTCAG 1 cut(s) 74
BslFI GGGAC 2 cut(s) 114, 165
BsmAI GTCTC 1 cut(s) 63
BsmFI GGGAC 2 cut(s) 114, 165
BspCNI CTCAG 1 cut(s) 73
BspLI GGNNCC 2 cut(s) 102, 103
BssECI CCNNGG 1 cut(s) 123
BssT1I CCWWGG 1 cut(s) 123
BstAPI GCANNNNNTGC 1 cut(s) 182
BstDEI CTNAG 1 cut(s) 60
BstMAI GTCTC 1 cut(s) 63
BstMWI GCNNNNNNNGC 1 cut(s) 182
Cfr13I GGNCC 1 cut(s) 101
Csp6I GTAC 3 cut(s) 26, 33, 250
CviAII CATG 1 cut(s) 107
CviJI RGCY 1 cut(s) 145
CviKI_1 RGCY 1 cut(s) 145
CviQI GTAC 3 cut(s) 26, 33, 250
DdeI CTNAG 1 cut(s) 60
Eco130I CCWWGG 1 cut(s) 123
Eco47I GGWCC 1 cut(s) 101
EcoO109I RGGNCCY 1 cut(s) 101
EcoT14I CCWWGG 1 cut(s) 123
ErhI CCWWGG 1 cut(s) 123
FaeI CATG 1 cut(s) 110
FaiI YATR 2 cut(s) 108, 138
FaqI GGGAC 2 cut(s) 114, 165
FatI CATG 1 cut(s) 106
FspBI CTAG 1 cut(s) 23
Hin1II CATG 1 cut(s) 110
HinfI GANTC 1 cut(s) 51
HphI GGTGA 1 cut(s) 217
Hpy188I TCNGA 2 cut(s) 50, 63
Hpy188III TCNNGA 1 cut(s) 74
HpyCH4V TGCA 3 cut(s) 140, 176, 242
HpyF10VI GCNNNNNNNGC 1 cut(s) 182
HpyF3I CTNAG 1 cut(s) 60
Hsp92II CATG 1 cut(s) 110
KflI GGGWCCC 1 cut(s) 101
LpnPI CCDG 4 cut(s) 59, 83, 114, 133
LweI GCATC 3 cut(s) 163, 172, 237
MaeI CTAG 1 cut(s) 23
MboII GAAGA 1 cut(s) 144
MfeI CAATTG 3 cut(s) 168, 189, 243
MluCI AATT 4 cut(s) 168, 189, 237, 243
MnlI CCTC 2 cut(s) 39, 196
MunI CAATTG 3 cut(s) 168, 189, 243
MwoI GCNNNNNNNGC 1 cut(s) 182
NlaIII CATG 1 cut(s) 110
NlaIV GGNNCC 2 cut(s) 102, 103
PfeI GAWTC 1 cut(s) 51
PpuMI RGGWCCY 1 cut(s) 101
Psp5II RGGWCCY 1 cut(s) 101
PspN4I GGNNCC 2 cut(s) 102, 103
PspPI GGNCC 1 cut(s) 101
PspPPI RGGWCCY 1 cut(s) 101
RsaI GTAC 3 cut(s) 27, 34, 251
RsaNI GTAC 3 cut(s) 26, 33, 250
Sau96I GGNCC 1 cut(s) 101
ScaI AGTACT 1 cut(s) 251
SetI ASST 3 cut(s) 31, 147, 207
SfaNI GCATC 3 cut(s) 163, 172, 237
SinI GGWCC 1 cut(s) 101
Sse9I AATT 4 cut(s) 168, 189, 237, 243
SspMI CTAG 1 cut(s) 23
StyI CCWWGG 1 cut(s) 123
TasI AATT 4 cut(s) 168, 189, 237, 243
TatI WGTACW 1 cut(s) 249
TfiI GAWTC 1 cut(s) 51
TspDTI ATGAA 1 cut(s) 225
VpaK11BI GGWCC 1 cut(s) 101
XspI CTAG 1 cut(s) 23
ZrmI AGTACT 1 cut(s) 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.