Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0009724

Physical Location & Seq

Genomic Coordinates Reverse (-)

86751092 .. 86752799

Gene Structure 1708 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ35505

Sequence Viewer

CDS Protein Promoter (2k)

Length: 138 bp

ATGGAGGTGGTGGTGGTGGTGGCATTCTTCGATGCAGAAATAAAGAAAATGAAGATTAAAAATTGCTACTTTCCTTTGTTCGTCTCCCCTGCTGTTCTGGAAAAAGAGAAGGATCATATAGAGGGTTTGAAACTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004812 GO:0004827 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0005911 GO:0006082 GO:0006139 GO:0006399 GO:0006412 GO:0006418 GO:0006433 GO:0006518 GO:0006520 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009506 GO:0009987 GO:0010467 GO:0016020 GO:0016070 GO:0016874 GO:0016875 GO:0017101 GO:0019538 GO:0019752 GO:0030054 GO:0032991 GO:0034641 GO:0034645 GO:0034660 GO:0043038 GO:0043039 GO:0043043 GO:0043170 GO:0043436 GO:0043603 GO:0043604 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044271 GO:0044281 GO:0044424 GO:0044444 GO:0044464 GO:0046483 GO:0055044 GO:0071704 GO:0090304 GO:0140098 GO:0140101 GO:1901360 GO:1901564 GO:1901566 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00970 map00970

Pfam Domains

Protein Families

HGTP_anticodon ProRS-C_1 tRNA-synt_2b

Protein Analysis

45

Amino Acids

5.2

Weight (kDa)

6.54

Isoelectric Point (pI)

51.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009724)

Species	Orthologous Gene IDs
malus_domestica	MD08G1148500.v1.1
pyrus_communis	pycom07g12970
rosa_chinensis	RchiOBHm_Chr1g0313171 RchiOBHm_Chr5g0080771 RchiOBHm_Chr6g0261551 RchiOBHm_Chr6g0261561 RchiOBHm_Chr6g0283351
rosa_multiflora	Rmu_sc0006634.1_g000006 Rmu_ssc0000066.1_g000014
rosa_roxburghii	Rroxscaffold_4G00321550 Rroxscaffold_5G00353030 Rroxscaffold_7G00162120
rosa_samantha	Rh1DG264100 Rh4AG050100 Rh4AG050200 Rh6DG261500
rosa_wichuraiana	Rw4G014170 Rw4G015360 Rw5G032300 Rw5G042170 Rw5G042180 Rw7G036200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	120
AgsI	TTSAA	1 cut(s)	130
Alw26I	GTCTC	1 cut(s)	88
AlwI	GGATC	1 cut(s)	120
BcoDI	GTCTC	1 cut(s)	88
BmsI	GCATC	1 cut(s)	22
BsmAI	GTCTC	1 cut(s)	88
BsmBI	CGTCTC	1 cut(s)	88
BsmI	GAATGC	1 cut(s)	23
Bsp143I	GATC	1 cut(s)	112
BspPI	GGATC	1 cut(s)	120
BssMI	GATC	1 cut(s)	112
BstKTI	GATC	1 cut(s)	115
BstMAI	GTCTC	1 cut(s)	88
BstMBI	GATC	1 cut(s)	112
DpnI	GATC	1 cut(s)	114
DpnII	GATC	1 cut(s)	112
Esp3I	CGTCTC	1 cut(s)	88
FaiI	YATR	2 cut(s)	117, 119
Hpy188III	TCNNGA	1 cut(s)	98
HpyAV	CCTTC	1 cut(s)	103
HpyCH4V	TGCA	1 cut(s)	35
Kzo9I	GATC	1 cut(s)	112
LpnPI	CCDG	2 cut(s)	83, 102
LweI	GCATC	1 cut(s)	22
MalI	GATC	1 cut(s)	114
MboI	GATC	1 cut(s)	112
MboII	GAAGA	2 cut(s)	19, 64
MluCI	AATT	1 cut(s)	61
MnlI	CCTC	1 cut(s)	115
MseI	TTAA	1 cut(s)	57
Mva1269I	GAATGC	1 cut(s)	23
NdeII	GATC	1 cut(s)	112
PctI	GAATGC	1 cut(s)	23
SaqAI	TTAA	1 cut(s)	57
Sau3AI	GATC	1 cut(s)	112
SetI	ASST	1 cut(s)	9
SfaNI	GCATC	1 cut(s)	22
SgeI	CNNG	2 cut(s)	101, 110
Sse9I	AATT	1 cut(s)	61
TaqI	TCGA	1 cut(s)	30
TasI	AATT	1 cut(s)	61
Tru1I	TTAA	1 cut(s)	57
Tru9I	TTAA	1 cut(s)	57
TspDTI	ATGAA	1 cut(s)	65

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.