RchiOBHm_Chr6g0254821

protein At2g34460, chloroplastic-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0008667
Physical Location & Seq
Reverse (-)
9730212 .. 9731947
1736 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22858

Sequence Viewer

Length: 222 bp
ATGGAGCATCAATGGGGCAGATTCTCAATCCAGCTTACATATTTCTTAATCTCAAAGCTTCAGGCAGAGCATTATATCAGGAAGTCTGGTATAAACTACACAATAATAAGGCCTGGTGAGTTGAGAAATGAACCTCTAACAGGAAATCTTGTGATGGAACCAGAGGTAAGTCAGGACACTATCTGGAGGCACCCATCTCCAGAGATCTGGTGGTGGAATTAG

Protein Analysis

73

Amino Acids

8.84

Weight (kDa)

6.26

Isoelectric Point (pI)

45.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAD_binding_10 PF13460 12 - 54 3.9e-09 NAD(P)H-binding
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 189
AcuI CTGAAG 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 140
AjnI CCWGG 1 cut(s) 112
AluBI AGCT 2 cut(s) 34, 58
AluI AGCT 2 cut(s) 34, 58
AoxI GGCC 1 cut(s) 110
AsuHPI GGTGA 1 cut(s) 128
BanI GGYRCC 1 cut(s) 189
BccI CCATC 2 cut(s) 148, 202
BciT130I CCWGG 1 cut(s) 114
BglII AGATCT 1 cut(s) 204
Bme1390I CCNGG 1 cut(s) 114
BmiI GGNNCC 2 cut(s) 159, 191
BmrFI CCNGG 1 cut(s) 114
BmsI GCATC 1 cut(s) 16
BpmI CTGGAG 2 cut(s) 183, 205
Bsc4I CCNNNNNNNGG 1 cut(s) 140
BseBI CCWGG 1 cut(s) 114
BseLI CCNNNNNNNGG 1 cut(s) 140
BshFI GGCC 1 cut(s) 112
BshNI GGYRCC 1 cut(s) 189
BslI CCNNNNNNNGG 1 cut(s) 140
BsnI GGCC 1 cut(s) 112
Bsp143I GATC 1 cut(s) 204
BspANI GGCC 1 cut(s) 112
BspLI GGNNCC 2 cut(s) 159, 191
BspT107I GGYRCC 1 cut(s) 189
BssMI GATC 1 cut(s) 204
Bst2UI CCWGG 1 cut(s) 114
BstENI CCTNNNNNAGG 1 cut(s) 138
BstKTI GATC 1 cut(s) 207
BstMBI GATC 1 cut(s) 204
BstNI CCWGG 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 112
BstX2I RGATCY 1 cut(s) 204
BstXI CCANNNNNNTGG 1 cut(s) 207
BstYI RGATCY 1 cut(s) 204
BsuRI GGCC 1 cut(s) 112
CviJI RGCY 3 cut(s) 34, 58, 112
CviKI_1 RGCY 3 cut(s) 34, 58, 112
DpnI GATC 1 cut(s) 206
DpnII GATC 1 cut(s) 204
Eco147I AGGCCT 1 cut(s) 112
Eco57I CTGAAG 1 cut(s) 44
EcoNI CCTNNNNNAGG 1 cut(s) 138
EcoRII CCWGG 1 cut(s) 112
FaiI YATR 3 cut(s) 40, 75, 92
GsuI CTGGAG 2 cut(s) 183, 205
HaeIII GGCC 1 cut(s) 112
HindIII AAGCTT 1 cut(s) 56
HinfI GANTC 1 cut(s) 21
HphI GGTGA 1 cut(s) 128
Hpy188III TCNNGA 4 cut(s) 79, 173, 184, 200
Kzo9I GATC 1 cut(s) 204
LmnI GCTCC 1 cut(s) 4
LweI GCATC 1 cut(s) 16
MalI GATC 1 cut(s) 206
MboI GATC 1 cut(s) 204
MflI RGATCY 1 cut(s) 204
MluCI AATT 1 cut(s) 217
MnlI CCTC 3 cut(s) 144, 157, 180
MseI TTAA 1 cut(s) 47
MspR9I CCNGG 1 cut(s) 114
MvaI CCWGG 1 cut(s) 114
NdeII GATC 1 cut(s) 204
NlaIV GGNNCC 2 cut(s) 159, 191
PceI AGGCCT 1 cut(s) 112
PfeI GAWTC 1 cut(s) 21
Psp6I CCWGG 1 cut(s) 112
PspGI CCWGG 1 cut(s) 112
PspN4I GGNNCC 2 cut(s) 159, 191
PsuI RGATCY 1 cut(s) 204
SaqAI TTAA 1 cut(s) 47
Sau3AI GATC 1 cut(s) 204
ScrFI CCNGG 1 cut(s) 114
SetI ASST 4 cut(s) 36, 60, 136, 168
SfaNI GCATC 1 cut(s) 16
Sse9I AATT 1 cut(s) 217
SseBI AGGCCT 1 cut(s) 112
StuI AGGCCT 1 cut(s) 112
StyD4I CCNGG 1 cut(s) 112
TasI AATT 1 cut(s) 217
TfiI GAWTC 1 cut(s) 21
Tru1I TTAA 1 cut(s) 47
Tru9I TTAA 1 cut(s) 47
TspDTI ATGAA 1 cut(s) 144
XagI CCTNNNNNAGG 1 cut(s) 138
XcmI CCANNNNNNNNNTGG 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.