RchiOBHm_Chr6g0270871

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0014098
Physical Location & Seq
Reverse (-)
28903001 .. 28903889
889 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24299

Sequence Viewer

Length: 621 bp
ATGGAGTCCTCATCAGCAACTCCAGGCAGAAACACAGTATTTCCAGCCATGAAGCTACATCCATATTCTTCCTCTCCAAGACGGCCATTTTCTTTTTCACCTTCATCTTTTGTATCATCCTTTAATGTCCCTGATCATGATGATTCCCCTGCCACCACCCCGTTTCGACTTTCTGGTGTCCCATTTTCCTGGGAACGTTTTCCTGGAATTCCAAAGAAACAAAGCTTCAATTGCAAGAAGAATGAACAGTACTGCAGCTCACCATCATTGAAGGTTCTCCCATTGCCTCCTACAACTGCTCATCAAGCTCCGAAAAAGAAGTCCTCATCCAACTCAAAGCAGACTAGTACATTTCCAAAAGATCCTTTTGTTGCTGCTTTAATTGAGTGTTCCAAGGAGGAAGATGAAGAAGAAGATCAATATTCCAAGAACAATGGTCAATGGAGTGCCAAGGTATCAAGAAGTGTAAGTGACAGGTTTGGATTTGTCAATCTTTATGCATCGTCGTGTAAAAGAAGTTGTGCAGTTTCTCAATCTATCATACATGTTCCGAGGCCGCTCAGTAGAACCTCCTCTAACTACGATCTACTTAGTCACCGTTCCCGTTCCCGTTCCCGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF688

Protein Analysis

206

Amino Acids

22.98

Weight (kDa)

9.71

Isoelectric Point (pI)

89.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014098)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G22680 AT1G71970
fragaria_vesca FvH4_2g11630
malus_domestica MD05G1042300.v1.1
prunus_persica Prupe.8G058900_v2.0.a1
pyrus_communis pycom05g03490 pycom10g03480
rosa_chinensis RchiOBHm_Chr6g0270871
rosa_laevigata RLG00000013763
rosa_multiflora Rmu_sc0010417.1_g000001
rosa_roxburghii Rroxscaffold_3G00238570 Rroxscaffold_7G00197560
rosa_samantha Rh6AG176400 Rh6BG179800 Rh6CG175800 Rh6DG168100
rosa_wichuraiana Rw6G015030

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 559
AciI CCGC 1 cut(s) 557
AclI AACGTT 1 cut(s) 196
AclWI GGATC 1 cut(s) 356
AcoI YGGCCR 1 cut(s) 83
AcsI RAATTY 1 cut(s) 207
AfaI GTAC 2 cut(s) 251, 349
AflIII ACRYGT 1 cut(s) 544
AgsI TTSAA 2 cut(s) 229, 271
AhlI ACTAGT 1 cut(s) 344
AjnI CCWGG 3 cut(s) 22, 188, 202
AluBI AGCT 4 cut(s) 55, 225, 258, 308
AluI AGCT 4 cut(s) 55, 225, 258, 308
AlwI GGATC 1 cut(s) 356
AoxI GGCC 2 cut(s) 83, 554
ApeKI GCWGC 2 cut(s) 255, 374
ApoI RAATTY 1 cut(s) 207
ArsI GACNNNNNNTTYG 2 cut(s) 305, 337
Asp700I GAANNNNTTC 1 cut(s) 198
AsuHPI GGTGA 3 cut(s) 90, 252, 587
BbvI GCAGC 2 cut(s) 267, 361
BccI CCATC 1 cut(s) 271
BceAI ACGGC 1 cut(s) 98
BciT130I CCWGG 3 cut(s) 24, 190, 204
BclI TGATCA 1 cut(s) 133
BcuI ACTAGT 1 cut(s) 344
BfaI CTAG 1 cut(s) 345
BfmI CTRYAG 1 cut(s) 253
BisI GCNGC 3 cut(s) 256, 375, 557
BlsI GCNGC 3 cut(s) 257, 376, 558
BmcAI AGTACT 1 cut(s) 251
Bme1390I CCNGG 3 cut(s) 24, 190, 204
BmrFI CCNGG 3 cut(s) 24, 190, 204
BmsI GCATC 1 cut(s) 509
BpmI CTGGAG 1 cut(s) 6
BsaJI CCNNGG 4 cut(s) 189, 393, 450, 551
Bse3DI GCAATG 1 cut(s) 281
BseBI CCWGG 3 cut(s) 24, 190, 204
BseDI CCNNGG 4 cut(s) 189, 393, 450, 551
BseGI GGATG 3 cut(s) 58, 116, 326
BseMI GCAATG 1 cut(s) 281
BseMII CTCAG 1 cut(s) 574
BseRI GAGGAG 1 cut(s) 562
BseXI GCAGC 2 cut(s) 267, 361
BsgI GTGCAG 1 cut(s) 543
BshFI GGCC 2 cut(s) 85, 556
BslFI GGGAC 2 cut(s) 113, 164
BsmFI GGGAC 2 cut(s) 113, 164
BsnI GGCC 2 cut(s) 85, 556
Bsp143I GATC 4 cut(s) 133, 361, 415, 583
BspACI CCGC 1 cut(s) 557
BspANI GGCC 2 cut(s) 85, 556
BspCNI CTCAG 1 cut(s) 573
BspHI TCATGA 1 cut(s) 136
BspMAI CTGCAG 1 cut(s) 257
BspPI GGATC 1 cut(s) 356
BsrBI CCGCTC 1 cut(s) 559
BsrDI GCAATG 1 cut(s) 281
BssECI CCNNGG 4 cut(s) 189, 393, 450, 551
BssMI GATC 4 cut(s) 133, 361, 415, 583
BssT1I CCWWGG 2 cut(s) 393, 450
Bst2UI CCWGG 3 cut(s) 24, 190, 204
Bst4CI ACNGT 3 cut(s) 37, 249, 599
BstDEI CTNAG 2 cut(s) 560, 590
BstF5I GGATG 3 cut(s) 58, 116, 326
BstKTI GATC 4 cut(s) 136, 364, 418, 586
BstMBI GATC 4 cut(s) 133, 361, 415, 583
BstMWI GCNNNNNNNGC 2 cut(s) 231, 305
BstNI CCWGG 3 cut(s) 24, 190, 204
BstNSI RCATGY 1 cut(s) 548
BstSCI CCNGG 3 cut(s) 22, 188, 202
BstSFI CTRYAG 1 cut(s) 253
BstV1I GCAGC 2 cut(s) 267, 361
BstX2I RGATCY 1 cut(s) 361
BstXI CCANNNNNNTGG 1 cut(s) 189
BstYI RGATCY 1 cut(s) 361
BsuRI GGCC 2 cut(s) 85, 556
BtsCI GGATG 3 cut(s) 58, 116, 326
CciI TCATGA 1 cut(s) 136
Csp6I GTAC 2 cut(s) 250, 348
CviAII CATG 3 cut(s) 49, 137, 545
CviJI RGCY 7 cut(s) 47, 55, 85, 225, 258, 308, 556
CviKI_1 RGCY 7 cut(s) 47, 55, 85, 225, 258, 308, 556
CviQI GTAC 2 cut(s) 250, 348
DdeI CTNAG 2 cut(s) 560, 590
DpnI GATC 4 cut(s) 135, 363, 417, 585
DpnII GATC 4 cut(s) 133, 361, 415, 583
EaeI YGGCCR 1 cut(s) 83
Eco130I CCWWGG 2 cut(s) 393, 450
EcoRI GAATTC 1 cut(s) 207
EcoRII CCWGG 3 cut(s) 22, 188, 202
EcoT14I CCWWGG 2 cut(s) 393, 450
EcoT22I ATGCAT 1 cut(s) 502
ErhI CCWWGG 2 cut(s) 393, 450
FaeI CATG 3 cut(s) 52, 140, 548
FaiI YATR 6 cut(s) 50, 64, 138, 498, 542, 546
FaqI GGGAC 2 cut(s) 113, 164
FatI CATG 3 cut(s) 48, 136, 544
FbaI TGATCA 1 cut(s) 133
Fnu4HI GCNGC 3 cut(s) 256, 375, 557
FokI GGATG 3 cut(s) 45, 103, 313
Fsp4HI GCNGC 3 cut(s) 256, 375, 557
FspBI CTAG 1 cut(s) 345
GluI GCNGC 3 cut(s) 256, 375, 557
GsuI CTGGAG 1 cut(s) 6
HaeIII GGCC 2 cut(s) 85, 556
Hin1II CATG 3 cut(s) 52, 140, 548
HindIII AAGCTT 1 cut(s) 223
HinfI GANTC 2 cut(s) 5, 143
HphI GGTGA 3 cut(s) 90, 252, 587
Hpy188I TCNGA 2 cut(s) 312, 552
Hpy188III TCNNGA 3 cut(s) 137, 459, 615
Hpy99I CGWCG 1 cut(s) 508
HpyAV CCTTC 2 cut(s) 111, 265
HpyCH4III ACNGT 3 cut(s) 37, 249, 599
HpyCH4IV ACGT 1 cut(s) 196
HpyCH4V TGCA 4 cut(s) 234, 255, 500, 524
HpyF10VI GCNNNNNNNGC 2 cut(s) 231, 305
HpyF3I CTNAG 2 cut(s) 560, 590
HpySE526I ACGT 1 cut(s) 196
Hsp92II CATG 3 cut(s) 52, 140, 548
Ksp22I TGATCA 1 cut(s) 133
Kzo9I GATC 4 cut(s) 133, 361, 415, 583
LmnI GCTCC 1 cut(s) 313
Lsp1109I GCAGC 2 cut(s) 267, 361
LweI GCATC 1 cut(s) 509
MaeI CTAG 1 cut(s) 345
MaeII ACGT 1 cut(s) 196
MaeIII GTNAC 2 cut(s) 470, 593
MalI GATC 4 cut(s) 135, 363, 417, 585
MbiI CCGCTC 1 cut(s) 559
MboI GATC 4 cut(s) 133, 361, 415, 583
MboII GAAGA 6 cut(s) 60, 250, 413, 419, 422, 425
MfeI CAATTG 1 cut(s) 229
MflI RGATCY 1 cut(s) 361
MluCI AATT 3 cut(s) 207, 229, 381
MlyI GAGTC 1 cut(s) 14
MmeI TCCRAC 1 cut(s) 354
MnlI CCTC 8 cut(s) 19, 82, 297, 334, 391, 546, 580, 583
Mph1103I ATGCAT 1 cut(s) 502
MroXI GAANNNNTTC 1 cut(s) 198
MseI TTAA 2 cut(s) 123, 380
MslI CAYNNNNRTG 1 cut(s) 505
MspR9I CCNGG 3 cut(s) 24, 190, 204
MunI CAATTG 1 cut(s) 229
MvaI CCWGG 3 cut(s) 24, 190, 204
MwoI GCNNNNNNNGC 2 cut(s) 231, 305
NdeII GATC 4 cut(s) 133, 361, 415, 583
NlaIII CATG 3 cut(s) 52, 140, 548
NmuCI GTSAC 2 cut(s) 470, 593
NsiI ATGCAT 1 cut(s) 502
NspI RCATGY 1 cut(s) 548
PagI TCATGA 1 cut(s) 136
PciI ACATGT 1 cut(s) 544
PdmI GAANNNNTTC 1 cut(s) 198
PfeI GAWTC 1 cut(s) 143
PfoI TCCNGGA 1 cut(s) 202
PkrI GCNGC 3 cut(s) 257, 376, 558
PleI GAGTC 1 cut(s) 13
PpsI GAGTC 1 cut(s) 13
PscI ACATGT 1 cut(s) 544
Psp1406I AACGTT 1 cut(s) 196
Psp6I CCWGG 3 cut(s) 22, 188, 202
PspGI CCWGG 3 cut(s) 22, 188, 202
PstI CTGCAG 1 cut(s) 257
PsuI RGATCY 1 cut(s) 361
RsaI GTAC 2 cut(s) 251, 349
RsaNI GTAC 2 cut(s) 250, 348
RseI CAYNNNNRTG 1 cut(s) 505
SaqAI TTAA 2 cut(s) 123, 380
SatI GCNGC 3 cut(s) 256, 375, 557
Sau3AI GATC 4 cut(s) 133, 361, 415, 583
ScaI AGTACT 1 cut(s) 251
SchI GAGTC 1 cut(s) 14
ScrFI CCNGG 3 cut(s) 24, 190, 204
SfaNI GCATC 1 cut(s) 509
SfcI CTRYAG 1 cut(s) 253
SmiMI CAYNNNNRTG 1 cut(s) 505
SpeI ACTAGT 1 cut(s) 344
Sse9I AATT 3 cut(s) 207, 229, 381
SsiI CCGC 1 cut(s) 557
SspI AATATT 1 cut(s) 422
SspMI CTAG 1 cut(s) 345
StyD4I CCNGG 3 cut(s) 22, 188, 202
StyI CCWWGG 2 cut(s) 393, 450
TaaI ACNGT 3 cut(s) 37, 249, 599
TaiI ACGT 1 cut(s) 199
TaqI TCGA 1 cut(s) 166
TasI AATT 3 cut(s) 207, 229, 381
TatI WGTACW 2 cut(s) 249, 347
TauI GCSGC 1 cut(s) 559
TfiI GAWTC 1 cut(s) 143
Tru1I TTAA 2 cut(s) 123, 380
Tru9I TTAA 2 cut(s) 123, 380
TseFI GTSAC 2 cut(s) 470, 593
TseI GCWGC 2 cut(s) 255, 374
Tsp45I GTSAC 2 cut(s) 470, 593
TspDTI ATGAA 4 cut(s) 65, 93, 258, 420
XapI RAATTY 1 cut(s) 207
XceI RCATGY 1 cut(s) 548
XmnI GAANNNNTTC 1 cut(s) 198
XspI CTAG 1 cut(s) 345
ZrmI AGTACT 1 cut(s) 251
Zsp2I ATGCAT 1 cut(s) 502
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.