RchiOBHm_Chr7g0188851

Lysosomal alpha-mannosidase-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
8233451 .. 8235284
1834 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16866

Sequence Viewer

Length: 207 bp
ATGAATCCTTCCTACAGTTTACCAAATAATGTTGCAATATTAACCATCCAGGAGCTGGAAGATGGAAAAGTTCTCTTTCGCCTGGCACATTTATACGAGATTGAAGAGGACAAGAACCTTTCAGTTATGGCGAGTGTAGAACTAAAAAAAGTGTTTGCAGATAAGAGGGTAGATAGATATCGATCTCTTATTACTAGTGAATACTAG

Protein Analysis

68

Amino Acids

7.9

Weight (kDa)

5.26

Isoelectric Point (pI)

38.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 55
AfiI CCNNNNNNNGG 1 cut(s) 55
AgsI TTSAA 1 cut(s) 104
AhlI ACTAGT 1 cut(s) 194
AjnI CCWGG 2 cut(s) 48, 81
AluBI AGCT 1 cut(s) 55
AluI AGCT 1 cut(s) 55
AlwNI CAGNNNCTG 1 cut(s) 55
BccI CCATC 2 cut(s) 53, 56
BciT130I CCWGG 2 cut(s) 50, 83
BcuI ACTAGT 1 cut(s) 194
BfaI CTAG 2 cut(s) 195, 205
BfmI CTRYAG 1 cut(s) 13
Bme1390I CCNGG 2 cut(s) 50, 83
BmrFI CCNGG 2 cut(s) 50, 83
Bsa29I ATCGAT 1 cut(s) 181
BsaBI GATNNNNATC 2 cut(s) 177, 181
Bsc4I CCNNNNNNNGG 1 cut(s) 55
Bse8I GATNNNNATC 2 cut(s) 177, 181
BseBI CCWGG 2 cut(s) 50, 83
BseCI ATCGAT 1 cut(s) 181
BseGI GGATG 1 cut(s) 45
BseJI GATNNNNATC 2 cut(s) 177, 181
BseLI CCNNNNNNNGG 1 cut(s) 55
BshVI ATCGAT 1 cut(s) 181
BslI CCNNNNNNNGG 1 cut(s) 55
Bsp143I GATC 1 cut(s) 182
BspDI ATCGAT 1 cut(s) 181
BssMI GATC 1 cut(s) 182
Bst2UI CCWGG 2 cut(s) 50, 83
Bst4CI ACNGT 1 cut(s) 17
Bst6I CTCTTC 1 cut(s) 99
BstF5I GGATG 1 cut(s) 45
BstKTI GATC 1 cut(s) 185
BstMBI GATC 1 cut(s) 182
BstNI CCWGG 2 cut(s) 50, 83
BstSCI CCNGG 2 cut(s) 48, 81
BstSFI CTRYAG 1 cut(s) 13
Bsu15I ATCGAT 1 cut(s) 181
BsuTUI ATCGAT 1 cut(s) 181
BtsCI GGATG 1 cut(s) 45
CaiI CAGNNNCTG 1 cut(s) 55
ClaI ATCGAT 1 cut(s) 181
CviJI RGCY 1 cut(s) 55
CviKI_1 RGCY 1 cut(s) 55
DpnI GATC 1 cut(s) 184
DpnII GATC 1 cut(s) 182
Eam1104I CTCTTC 1 cut(s) 99
EarI CTCTTC 1 cut(s) 99
Eco32I GATATC 1 cut(s) 179
EcoRII CCWGG 2 cut(s) 48, 81
EcoRV GATATC 1 cut(s) 179
FaiI YATR 2 cut(s) 94, 128
FokI GGATG 1 cut(s) 32
FspBI CTAG 2 cut(s) 195, 205
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 1 cut(s) 20
Hpy8I GTNNAC 1 cut(s) 20
HpyAV CCTTC 1 cut(s) 18
HpyCH4III ACNGT 1 cut(s) 17
HpyCH4V TGCA 2 cut(s) 35, 158
Kzo9I GATC 1 cut(s) 182
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 5 cut(s) 35, 41, 62, 68, 95
MaeI CTAG 2 cut(s) 195, 205
MalI GATC 1 cut(s) 184
MboI GATC 1 cut(s) 182
MboII GAAGA 2 cut(s) 71, 116
MnlI CCTC 2 cut(s) 100, 159
MseI TTAA 1 cut(s) 41
MspR9I CCNGG 2 cut(s) 50, 83
MvaI CCWGG 2 cut(s) 50, 83
NdeII GATC 1 cut(s) 182
PfeI GAWTC 1 cut(s) 4
PflMI CCANNNNNTGG 1 cut(s) 55
PfoI TCCNGGA 1 cut(s) 48
Psp6I CCWGG 2 cut(s) 48, 81
PspGI CCWGG 2 cut(s) 48, 81
PstNI CAGNNNCTG 1 cut(s) 55
SaqAI TTAA 1 cut(s) 41
Sau3AI GATC 1 cut(s) 182
ScrFI CCNGG 2 cut(s) 50, 83
SetI ASST 2 cut(s) 57, 120
SfcI CTRYAG 1 cut(s) 13
SgeI CNNG 8 cut(s) 61, 62, 68, 94, 95, 109, 124, 144
SpeI ACTAGT 1 cut(s) 194
SspI AATATT 1 cut(s) 39
SspMI CTAG 2 cut(s) 195, 205
StyD4I CCNGG 2 cut(s) 48, 81
TaaI ACNGT 1 cut(s) 17
TaqI TCGA 1 cut(s) 181
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 1 cut(s) 41
Tru9I TTAA 1 cut(s) 41
TspDTI ATGAA 1 cut(s) 17
Van91I CCANNNNNTGG 1 cut(s) 55
XcmI CCANNNNNNNNNTGG 1 cut(s) 52
XspI CTAG 2 cut(s) 195, 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.