Rh7BG101300

Lysosomal alpha-mannosidase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0013740
Physical Location & Seq
Reverse (-)
7534412 .. 7534707
296 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG101300.1

Sequence Viewer

Length: 231 bp
ATGACGGTTGTGGCTTGCTTTAGGCTTGTACTAGTATTTACTGTGTTCCTACATGCGGAGGAGTCCAAGTACGTACAGTACAATACAACATCGGTCCTTGTTCCCGGAAAGCTGAACGTTCATTTGGTCGCTCACACCCACGACGACGTCGGATGGCTGAAGACCATTGACCAGAACTACGTTGGCTCCAATAATTCCTTCCAGGATCTGAATGATCGCCTTGTGTTCTGA

Protein Analysis

76

Amino Acids

8.67

Weight (kDa)

5.99

Isoelectric Point (pI)

19.61

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_38N PF01074 39 - 69 2.1e-06 Glycosyl hydrolases family 38 N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 150
AciI CCGC 1 cut(s) 56
AclI AACGTT 1 cut(s) 117
AclWI GGATC 1 cut(s) 213
AcuI CTGAAG 1 cut(s) 179
AcyI GRCGYC 1 cut(s) 147
AfaI GTAC 4 cut(s) 30, 71, 75, 80
AfiI CCNNNNNNNGG 1 cut(s) 55
AhlI ACTAGT 1 cut(s) 31
AjnI CCWGG 1 cut(s) 201
AjuI GAANNNNNNNTTGG 4 cut(s) 107, 139, 182, 214
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
AlwI GGATC 1 cut(s) 213
AlwNI CAGNNNCTG 1 cut(s) 208
AspS9I GGNCC 1 cut(s) 94
AsuC2I CCSGG 1 cut(s) 105
AvaII GGWCC 1 cut(s) 94
BbsI GAAGAC 1 cut(s) 167
BccI CCATC 1 cut(s) 147
BciT130I CCWGG 1 cut(s) 203
BcnI CCSGG 1 cut(s) 105
BcuI ACTAGT 1 cut(s) 31
BfaI CTAG 1 cut(s) 32
Bme1390I CCNGG 2 cut(s) 105, 203
Bme18I GGWCC 1 cut(s) 94
BmgT120I GGNCC 1 cut(s) 94
BmiI GGNNCC 1 cut(s) 187
BmrFI CCNGG 2 cut(s) 105, 203
BpiI GAAGAC 1 cut(s) 167
BpuMI CCSGG 1 cut(s) 105
BsaAI YACGTR 1 cut(s) 73
BsaHI GRCGYC 1 cut(s) 147
BsaXI ACNNNNNCTCC 4 cut(s) 53, 83, 170, 200
Bsc4I CCNNNNNNNGG 1 cut(s) 55
BseBI CCWGG 1 cut(s) 203
BseGI GGATG 1 cut(s) 158
BseLI CCNNNNNNNGG 1 cut(s) 55
BseRI GAGGAG 1 cut(s) 74
BsiSI CCGG 1 cut(s) 105
BslI CCNNNNNNNGG 1 cut(s) 55
Bsp143I GATC 2 cut(s) 205, 214
BspACI CCGC 1 cut(s) 56
BspLI GGNNCC 1 cut(s) 187
BspPI GGATC 1 cut(s) 213
BssMI GATC 2 cut(s) 205, 214
BssNI GRCGYC 1 cut(s) 147
Bst2UI CCWGG 1 cut(s) 203
Bst4CI ACNGT 3 cut(s) 7, 43, 78
BstACI GRCGYC 1 cut(s) 147
BstBAI YACGTR 1 cut(s) 73
BstC8I GCNNGC 1 cut(s) 16
BstF5I GGATG 1 cut(s) 158
BstKTI GATC 2 cut(s) 208, 217
BstMBI GATC 2 cut(s) 205, 214
BstNI CCWGG 1 cut(s) 203
BstNSI RCATGY 1 cut(s) 56
BstSCI CCNGG 2 cut(s) 103, 201
BstSNI TACGTA 1 cut(s) 73
BstV2I GAAGAC 1 cut(s) 167
BstX2I RGATCY 1 cut(s) 205
BstYI RGATCY 1 cut(s) 205
BtsCI GGATG 1 cut(s) 158
Cac8I GCNNGC 1 cut(s) 16
CaiI CAGNNNCTG 1 cut(s) 208
Cfr13I GGNCC 1 cut(s) 94
Csp6I GTAC 4 cut(s) 29, 70, 74, 79
CviAII CATG 1 cut(s) 53
CviJI RGCY 5 cut(s) 14, 25, 112, 157, 186
CviKI_1 RGCY 5 cut(s) 14, 25, 112, 157, 186
CviQI GTAC 4 cut(s) 29, 70, 74, 79
DpnI GATC 2 cut(s) 207, 216
DpnII GATC 2 cut(s) 205, 214
Eco105I TACGTA 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 94
Eco57I CTGAAG 1 cut(s) 179
EcoRII CCWGG 1 cut(s) 201
FaeI CATG 1 cut(s) 56
FaiI YATR 1 cut(s) 54
FatI CATG 1 cut(s) 52
FokI GGATG 1 cut(s) 165
FspBI CTAG 1 cut(s) 32
HapII CCGG 1 cut(s) 105
Hin1I GRCGYC 1 cut(s) 147
Hin1II CATG 1 cut(s) 56
HinfI GANTC 1 cut(s) 62
HpaII CCGG 1 cut(s) 105
Hpy188I TCNGA 3 cut(s) 152, 210, 230
Hpy99I CGWCG 3 cut(s) 146, 149, 152
HpyAV CCTTC 1 cut(s) 208
HpyCH4III ACNGT 3 cut(s) 7, 43, 78
HpyCH4IV ACGT 4 cut(s) 72, 117, 147, 180
HpySE526I ACGT 4 cut(s) 72, 117, 147, 180
Hsp92I GRCGYC 1 cut(s) 147
Hsp92II CATG 1 cut(s) 56
Kzo9I GATC 2 cut(s) 205, 214
LmnI GCTCC 1 cut(s) 191
LpnPI CCDG 4 cut(s) 118, 185, 188, 215
MaeI CTAG 1 cut(s) 32
MaeII ACGT 4 cut(s) 72, 117, 147, 180
MalI GATC 2 cut(s) 207, 216
MboI GATC 2 cut(s) 205, 214
MboII GAAGA 1 cut(s) 172
MflI RGATCY 1 cut(s) 205
MluCI AATT 1 cut(s) 193
MlyI GAGTC 1 cut(s) 71
MmeI TCCRAC 1 cut(s) 130
MnlI CCTC 1 cut(s) 52
MspI CCGG 1 cut(s) 105
MspR9I CCNGG 2 cut(s) 105, 203
MvaI CCWGG 1 cut(s) 203
NciI CCSGG 1 cut(s) 105
NdeII GATC 2 cut(s) 205, 214
NlaIII CATG 1 cut(s) 56
NlaIV GGNNCC 1 cut(s) 187
NspI RCATGY 1 cut(s) 56
PflFI GACNNNGTC 1 cut(s) 146
PfoI TCCNGGA 2 cut(s) 103, 201
PleI GAGTC 1 cut(s) 70
PpsI GAGTC 1 cut(s) 70
Ppu21I YACGTR 1 cut(s) 73
Psp1406I AACGTT 1 cut(s) 117
Psp6I CCWGG 1 cut(s) 201
PspGI CCWGG 1 cut(s) 201
PspN4I GGNNCC 1 cut(s) 187
PspPI GGNCC 1 cut(s) 94
PstNI CAGNNNCTG 1 cut(s) 208
PsuI RGATCY 1 cut(s) 205
PsyI GACNNNGTC 1 cut(s) 146
RsaI GTAC 4 cut(s) 30, 71, 75, 80
RsaNI GTAC 4 cut(s) 29, 70, 74, 79
Sau3AI GATC 2 cut(s) 205, 214
Sau96I GGNCC 1 cut(s) 94
SchI GAGTC 1 cut(s) 71
ScrFI CCNGG 2 cut(s) 105, 203
SetI ASST 5 cut(s) 75, 114, 120, 150, 183
SinI GGWCC 1 cut(s) 94
SnaBI TACGTA 1 cut(s) 73
SpeI ACTAGT 1 cut(s) 31
Sse9I AATT 1 cut(s) 193
SsiI CCGC 1 cut(s) 56
SspMI CTAG 1 cut(s) 32
StyD4I CCNGG 2 cut(s) 103, 201
TaaI ACNGT 3 cut(s) 7, 43, 78
TaiI ACGT 4 cut(s) 75, 120, 150, 183
TaqII GACCGA 1 cut(s) 82
TasI AATT 1 cut(s) 193
TatI WGTACW 2 cut(s) 28, 78
TspDTI ATGAA 1 cut(s) 110
Tth111I GACNNNGTC 1 cut(s) 146
VpaK11BI GGWCC 1 cut(s) 94
XceI RCATGY 1 cut(s) 56
XcmI CCANNNNNNNNNTGG 1 cut(s) 179
XspI CTAG 1 cut(s) 32
ZraI GACGTC 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.