Rh7CG102600

Lysosomal alpha-mannosidase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0013740
Physical Location & Seq
Reverse (-)
7695861 .. 7700114
4254 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG102600.1

Sequence Viewer

Length: 453 bp
ATGACTCTTTTGCCCTTTTCTTTTCAGAAATTACGGGGTGCTACTGATGGAGATCAGTGGACAAAATCTTATGTCACAACATTTTCAGGAATGGATCCTTCCTACAGTTTACCAGATAATGTTGCAACATTAACCATCCAGGAGCTGGAAGATGGAAAAGTTCTCTTTCGCCTGGCACATTTATACGAGATTGAAGAGGACAAGGACCTTTCAGTTATGGCAAGTGTAGAACTAAAAAAAGTGTTTGCAGATAAGAGGATAAAGCAAATAACAGAAATGAGCTTATCTGCTAATCAAGGAAGAGCTGAAATGGAGAAGAAGAGATTGGTCTGGAAAGTAGAAGGCTCCTCTGAAGAAGAACCAAACGTGTCGAGGGGAGGACCTGTTGATCCAACAGAGCTGGTGGTGGATCTTGCTCCAATGGAAATTCGAACATTTACGATCAACTTCTAG

Protein Analysis

150

Amino Acids

16.95

Weight (kDa)

4.81

Isoelectric Point (pI)

39.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro38C2 PF17677 40 - 146 4.5e-08 Glycosyl hydrolases family 38 C-terminal beta sandwich domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 145
AclWI GGATC 4 cut(s) 89, 102, 383, 417
AcsI RAATTY 1 cut(s) 426
AcuI CTGAAG 1 cut(s) 372
AfiI CCNNNNNNNGG 1 cut(s) 145
AflIII ACRYGT 1 cut(s) 366
AgsI TTSAA 1 cut(s) 194
AjnI CCWGG 2 cut(s) 138, 171
AjuI GAANNNNNNNTTGG 2 cut(s) 308, 340
AluBI AGCT 4 cut(s) 145, 282, 305, 400
AluI AGCT 4 cut(s) 145, 282, 305, 400
AlwI GGATC 4 cut(s) 89, 102, 383, 417
AlwNI CAGNNNCTG 1 cut(s) 145
ApoI RAATTY 1 cut(s) 426
AspS9I GGNCC 2 cut(s) 205, 380
AsuII TTCGAA 1 cut(s) 430
AvaII GGWCC 2 cut(s) 205, 380
BamHI GGATCC 1 cut(s) 94
BccI CCATC 3 cut(s) 41, 143, 146
BciT130I CCWGG 2 cut(s) 140, 173
BfaI CTAG 1 cut(s) 451
BfmI CTRYAG 1 cut(s) 103
Bme1390I CCNGG 2 cut(s) 140, 173
Bme18I GGWCC 2 cut(s) 205, 380
BmgT120I GGNCC 2 cut(s) 205, 380
BmiI GGNNCC 2 cut(s) 96, 346
BmrFI CCNGG 2 cut(s) 140, 173
Bpu14I TTCGAA 1 cut(s) 430
BsaBI GATNNNNATC 1 cut(s) 51
BsaXI ACNNNNNCTCC 2 cut(s) 369, 399
Bsc4I CCNNNNNNNGG 1 cut(s) 145
Bse8I GATNNNNATC 1 cut(s) 51
BseBI CCWGG 2 cut(s) 140, 173
BseGI GGATG 1 cut(s) 135
BseJI GATNNNNATC 1 cut(s) 51
BseLI CCNNNNNNNGG 1 cut(s) 145
BseRI GAGGAG 1 cut(s) 337
BslI CCNNNNNNNGG 1 cut(s) 145
Bsp119I TTCGAA 1 cut(s) 430
Bsp143I GATC 5 cut(s) 52, 94, 388, 409, 441
BspLI GGNNCC 2 cut(s) 96, 346
BspPI GGATC 4 cut(s) 89, 102, 383, 417
BspQI GCTCTTC 1 cut(s) 295
BspT104I TTCGAA 1 cut(s) 430
BssMI GATC 5 cut(s) 52, 94, 388, 409, 441
Bst2UI CCWGG 2 cut(s) 140, 173
Bst4CI ACNGT 1 cut(s) 107
Bst6I CTCTTC 3 cut(s) 189, 295, 314
BstBI TTCGAA 1 cut(s) 430
BstF5I GGATG 1 cut(s) 135
BstKTI GATC 5 cut(s) 55, 97, 391, 412, 444
BstMBI GATC 5 cut(s) 52, 94, 388, 409, 441
BstNI CCWGG 2 cut(s) 140, 173
BstSCI CCNGG 2 cut(s) 138, 171
BstSFI CTRYAG 1 cut(s) 103
BstX2I RGATCY 2 cut(s) 94, 409
BstYI RGATCY 2 cut(s) 94, 409
BtsCI GGATG 1 cut(s) 135
BtsIMutI CAGTG 1 cut(s) 62
CaiI CAGNNNCTG 1 cut(s) 145
Cfr13I GGNCC 2 cut(s) 205, 380
CviJI RGCY 5 cut(s) 145, 282, 305, 345, 400
CviKI_1 RGCY 5 cut(s) 145, 282, 305, 345, 400
DpnI GATC 5 cut(s) 54, 96, 390, 411, 443
DpnII GATC 5 cut(s) 52, 94, 388, 409, 441
Eam1104I CTCTTC 3 cut(s) 189, 295, 314
EarI CTCTTC 3 cut(s) 189, 295, 314
Eco47I GGWCC 2 cut(s) 205, 380
Eco57I CTGAAG 1 cut(s) 372
EcoO109I RGGNCCY 2 cut(s) 205, 380
EcoRII CCWGG 2 cut(s) 138, 171
FaiI YATR 3 cut(s) 72, 184, 218
FokI GGATG 1 cut(s) 122
FspBI CTAG 1 cut(s) 451
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 2 cut(s) 60, 110
Hpy188I TCNGA 2 cut(s) 27, 352
Hpy188III TCNNGA 2 cut(s) 87, 331
Hpy8I GTNNAC 2 cut(s) 60, 110
HpyAV CCTTC 2 cut(s) 108, 335
HpyCH4III ACNGT 1 cut(s) 107
HpyCH4IV ACGT 1 cut(s) 366
HpyCH4V TGCA 2 cut(s) 125, 248
HpySE526I ACGT 1 cut(s) 366
Kzo9I GATC 5 cut(s) 52, 94, 388, 409, 441
LguI GCTCTTC 1 cut(s) 295
LmnI GCTCC 3 cut(s) 142, 350, 421
MaeI CTAG 1 cut(s) 451
MaeII ACGT 1 cut(s) 366
MaeIII GTNAC 1 cut(s) 73
MalI GATC 5 cut(s) 54, 96, 390, 411, 443
MboI GATC 5 cut(s) 52, 94, 388, 409, 441
MboII GAAGA 7 cut(s) 161, 206, 312, 328, 331, 365, 368
MflI RGATCY 2 cut(s) 94, 409
MluCI AATT 2 cut(s) 29, 426
MmeI TCCRAC 1 cut(s) 416
MnlI CCTC 5 cut(s) 190, 249, 358, 366, 371
MseI TTAA 1 cut(s) 131
MspR9I CCNGG 2 cut(s) 140, 173
MvaI CCWGG 2 cut(s) 140, 173
NdeII GATC 5 cut(s) 52, 94, 388, 409, 441
NlaIV GGNNCC 2 cut(s) 96, 346
NmuCI GTSAC 1 cut(s) 73
NspV TTCGAA 1 cut(s) 430
PciSI GCTCTTC 1 cut(s) 295
PflMI CCANNNNNTGG 1 cut(s) 145
PfoI TCCNGGA 1 cut(s) 138
PpuMI RGGWCCY 2 cut(s) 205, 380
Psp5II RGGWCCY 2 cut(s) 205, 380
Psp6I CCWGG 2 cut(s) 138, 171
PspGI CCWGG 2 cut(s) 138, 171
PspN4I GGNNCC 2 cut(s) 96, 346
PspPI GGNCC 2 cut(s) 205, 380
PspPPI RGGWCCY 2 cut(s) 205, 380
PstNI CAGNNNCTG 1 cut(s) 145
PsuI RGATCY 2 cut(s) 94, 409
SapI GCTCTTC 1 cut(s) 295
SaqAI TTAA 1 cut(s) 131
Sau3AI GATC 5 cut(s) 52, 94, 388, 409, 441
Sau96I GGNCC 2 cut(s) 205, 380
ScrFI CCNGG 2 cut(s) 140, 173
SetI ASST 7 cut(s) 147, 210, 284, 307, 369, 385, 402
SfcI CTRYAG 1 cut(s) 103
SfuI TTCGAA 1 cut(s) 430
SinI GGWCC 2 cut(s) 205, 380
Sse9I AATT 2 cut(s) 29, 426
SspMI CTAG 1 cut(s) 451
StyD4I CCNGG 2 cut(s) 138, 171
TaaI ACNGT 1 cut(s) 107
TaiI ACGT 1 cut(s) 369
TaqI TCGA 2 cut(s) 371, 430
TasI AATT 2 cut(s) 29, 426
Tru1I TTAA 1 cut(s) 131
Tru9I TTAA 1 cut(s) 131
TscAI CASTG 1 cut(s) 62
TseFI GTSAC 1 cut(s) 73
Tsp45I GTSAC 1 cut(s) 73
TspRI CASTG 1 cut(s) 62
Van91I CCANNNNNTGG 1 cut(s) 145
VpaK11BI GGWCC 2 cut(s) 205, 380
XapI RAATTY 1 cut(s) 426
XcmI CCANNNNNNNNNTGG 1 cut(s) 142
XspI CTAG 1 cut(s) 451
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.