Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8010942.1

Orthogroup ID

OG0013740

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 519

Gene Structure 519 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8010942.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 288 bp

atggcggttgtggcttgctttaggcttgtattagtattcactgtgtttctacatgcggcggagtccaagtacgtacagtacaatacaacatcggtccttgttcctggaaagctgaacgttcatttggtcgctcacacccacgacgacgtcggatggctgaagaccatggaccagtactacgttggctccaataattccttccaggaagcttgtgttcagaacgtgctggattcgttggtactggcattgttggccgataagaaccgcaagtttgtttacactgagcag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000323 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005764 GO:0005773 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko00511 map00511

Pfam Domains

Protein Families

Alpha-mann_mid Glyco_hydro_38 Glyco_hydro_38C

Protein Analysis

96

Amino Acids

10.84

Weight (kDa)

6.38

Isoelectric Point (pI)

23.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013740)

Species	Orthologous Gene IDs
pyrus_communis	pycom02g10050 pycom06g12320 pycom17g00270
rosa_chinensis	RchiOBHm_Chr7g0188851 RchiOBHm_Chr7g0188871 RchiOBHm_Chr7g0188881
rosa_multiflora	Rmu_co8010942.1_g000001 Rmu_sc0040167.1_g000001
rosa_rugosa	Rorug02G0077700 Rorug04G0116100 RorugMtG0004100.1
rosa_samantha	Rh6DG042700 Rh7AG099300 Rh7BG101300 Rh7CG102600 Rh7DG101000
rosa_wichuraiana	Rw3G020620 Rw7G008550

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	150
AciI	CCGC	4 cut(s)	5, 56, 59, 265
AclI	AACGTT	1 cut(s)	117
AcoI	YGGCCR	1 cut(s)	252
AcuI	CTGAAG	1 cut(s)	179
AcyI	GRCGYC	1 cut(s)	147
AfaI	GTAC	5 cut(s)	71, 75, 80, 176, 240
AjnI	CCWGG	2 cut(s)	103, 201
AjuI	GAANNNNNNNTTGG	4 cut(s)	107, 139, 182, 214
AluBI	AGCT	2 cut(s)	112, 209
AluI	AGCT	2 cut(s)	112, 209
AoxI	GGCC	1 cut(s)	252
AspS9I	GGNCC	2 cut(s)	94, 169
AvaII	GGWCC	2 cut(s)	94, 169
BbsI	GAAGAC	1 cut(s)	167
BccI	CCATC	1 cut(s)	147
BciT130I	CCWGG	2 cut(s)	105, 203
BisI	GCNGC	1 cut(s)	57
BlsI	GCNGC	1 cut(s)	58
BmcAI	AGTACT	1 cut(s)	176
Bme1390I	CCNGG	2 cut(s)	105, 203
Bme18I	GGWCC	2 cut(s)	94, 169
BmgT120I	GGNCC	2 cut(s)	94, 169
BmiI	GGNNCC	1 cut(s)	187
BmrFI	CCNGG	2 cut(s)	105, 203
BpiI	GAAGAC	1 cut(s)	167
BsaAI	YACGTR	1 cut(s)	73
BsaHI	GRCGYC	1 cut(s)	147
BsaJI	CCNNGG	1 cut(s)	165
BsaXI	ACNNNNNCTCC	4 cut(s)	53, 83, 170, 200
Bse1I	ACTGG	2 cut(s)	172, 246
BseBI	CCWGG	2 cut(s)	105, 203
BseDI	CCNNGG	1 cut(s)	165
BseGI	GGATG	1 cut(s)	158
BseMII	CTCAG	1 cut(s)	273
BseNI	ACTGG	2 cut(s)	172, 246
BshFI	GGCC	1 cut(s)	254
BsnI	GGCC	1 cut(s)	254
Bsp19I	CCATGG	1 cut(s)	165
BspACI	CCGC	4 cut(s)	5, 56, 59, 265
BspANI	GGCC	1 cut(s)	254
BspCNI	CTCAG	1 cut(s)	274
BspLI	GGNNCC	1 cut(s)	187
BsrI	ACTGG	2 cut(s)	172, 246
BssECI	CCNNGG	1 cut(s)	165
BssNI	GRCGYC	1 cut(s)	147
BssT1I	CCWWGG	1 cut(s)	165
Bst2UI	CCWGG	2 cut(s)	105, 203
Bst4CI	ACNGT	2 cut(s)	43, 78
BstACI	GRCGYC	1 cut(s)	147
BstBAI	YACGTR	1 cut(s)	73
BstC8I	GCNNGC	1 cut(s)	16
BstDEI	CTNAG	1 cut(s)	282
BstDSI	CCRYGG	1 cut(s)	165
BstF5I	GGATG	1 cut(s)	158
BstMWI	GCNNNNNNNGC	2 cut(s)	11, 251
BstNI	CCWGG	2 cut(s)	105, 203
BstNSI	RCATGY	1 cut(s)	56
BstSCI	CCNGG	2 cut(s)	103, 201
BstSNI	TACGTA	1 cut(s)	73
BstV2I	GAAGAC	1 cut(s)	167
BsuRI	GGCC	1 cut(s)	254
BtgI	CCRYGG	1 cut(s)	165
BtsCI	GGATG	1 cut(s)	158
BtsIMutI	CAGTG	2 cut(s)	39, 279
Cac8I	GCNNGC	1 cut(s)	16
Cfr13I	GGNCC	2 cut(s)	94, 169
Csp6I	GTAC	5 cut(s)	70, 74, 79, 175, 239
CviAII	CATG	2 cut(s)	53, 166
CviJI	RGCY	7 cut(s)	14, 25, 112, 157, 186, 209, 254
CviKI_1	RGCY	7 cut(s)	14, 25, 112, 157, 186, 209, 254
CviQI	GTAC	5 cut(s)	70, 74, 79, 175, 239
DdeI	CTNAG	1 cut(s)	282
EaeI	YGGCCR	1 cut(s)	252
EciI	GGCGGA	1 cut(s)	74
Eco105I	TACGTA	1 cut(s)	73
Eco130I	CCWWGG	1 cut(s)	165
Eco47I	GGWCC	2 cut(s)	94, 169
Eco57I	CTGAAG	1 cut(s)	179
EcoRII	CCWGG	2 cut(s)	103, 201
EcoT14I	CCWWGG	1 cut(s)	165
ErhI	CCWWGG	1 cut(s)	165
FaeI	CATG	2 cut(s)	56, 169
FaiI	YATR	2 cut(s)	54, 167
FatI	CATG	2 cut(s)	52, 165
Fnu4HI	GCNGC	1 cut(s)	57
FokI	GGATG	1 cut(s)	165
Fsp4HI	GCNGC	1 cut(s)	57
GluI	GCNGC	1 cut(s)	57
HaeIII	GGCC	1 cut(s)	254
Hin1I	GRCGYC	1 cut(s)	147
Hin1II	CATG	2 cut(s)	56, 169
HindIII	AAGCTT	1 cut(s)	207
HinfI	GANTC	2 cut(s)	62, 230
Hpy166II	GTNNAC	1 cut(s)	277
Hpy188I	TCNGA	2 cut(s)	152, 219
Hpy8I	GTNNAC	1 cut(s)	277
Hpy99I	CGWCG	3 cut(s)	146, 149, 152
HpyAV	CCTTC	1 cut(s)	208
HpyCH4III	ACNGT	2 cut(s)	43, 78
HpyCH4IV	ACGT	5 cut(s)	72, 117, 147, 180, 222
HpyF10VI	GCNNNNNNNGC	2 cut(s)	11, 251
HpyF3I	CTNAG	1 cut(s)	282
HpySE526I	ACGT	5 cut(s)	72, 117, 147, 180, 222
Hsp92I	GRCGYC	1 cut(s)	147
Hsp92II	CATG	2 cut(s)	56, 169
LmnI	GCTCC	1 cut(s)	191
LpnPI	CCDG	7 cut(s)	90, 117, 185, 188, 212, 215, 227
MaeII	ACGT	5 cut(s)	72, 117, 147, 180, 222
MboII	GAAGA	1 cut(s)	172
MluCI	AATT	1 cut(s)	193
MlyI	GAGTC	1 cut(s)	71
MmeI	TCCRAC	1 cut(s)	130
MspR9I	CCNGG	2 cut(s)	105, 203
MvaI	CCWGG	2 cut(s)	105, 203
MwoI	GCNNNNNNNGC	2 cut(s)	11, 251
NcoI	CCATGG	1 cut(s)	165
NlaIII	CATG	2 cut(s)	56, 169
NlaIV	GGNNCC	1 cut(s)	187
NspI	RCATGY	1 cut(s)	56
PfeI	GAWTC	1 cut(s)	230
PflFI	GACNNNGTC	1 cut(s)	146
PfoI	TCCNGGA	2 cut(s)	103, 201
PkrI	GCNGC	1 cut(s)	58
PleI	GAGTC	1 cut(s)	70
PpsI	GAGTC	1 cut(s)	70
Ppu21I	YACGTR	1 cut(s)	73
Psp1406I	AACGTT	1 cut(s)	117
Psp6I	CCWGG	2 cut(s)	103, 201
PspGI	CCWGG	2 cut(s)	103, 201
PspN4I	GGNNCC	1 cut(s)	187
PspPI	GGNCC	2 cut(s)	94, 169
PsyI	GACNNNGTC	1 cut(s)	146
RsaI	GTAC	5 cut(s)	71, 75, 80, 176, 240
RsaNI	GTAC	5 cut(s)	70, 74, 79, 175, 239
SatI	GCNGC	1 cut(s)	57
Sau96I	GGNCC	2 cut(s)	94, 169
ScaI	AGTACT	1 cut(s)	176
SchI	GAGTC	1 cut(s)	71
ScrFI	CCNGG	2 cut(s)	105, 203
SetI	ASST	7 cut(s)	75, 114, 120, 150, 183, 211, 225
SinI	GGWCC	2 cut(s)	94, 169
SnaBI	TACGTA	1 cut(s)	73
Sse9I	AATT	1 cut(s)	193
SsiI	CCGC	4 cut(s)	5, 56, 59, 265
StyD4I	CCNGG	2 cut(s)	103, 201
StyI	CCWWGG	1 cut(s)	165
TaaI	ACNGT	2 cut(s)	43, 78
TaiI	ACGT	5 cut(s)	75, 120, 150, 183, 225
TaqII	GACCGA	1 cut(s)	82
TasI	AATT	1 cut(s)	193
TatI	WGTACW	2 cut(s)	78, 174
TauI	GCSGC	1 cut(s)	59
TfiI	GAWTC	1 cut(s)	230
TscAI	CASTG	2 cut(s)	46, 286
TspDTI	ATGAA	1 cut(s)	110
TspRI	CASTG	2 cut(s)	46, 286
Tth111I	GACNNNGTC	1 cut(s)	146
VpaK11BI	GGWCC	2 cut(s)	94, 169
XceI	RCATGY	1 cut(s)	56
XcmI	CCANNNNNNNNNTGG	1 cut(s)	179
ZraI	GACGTC	1 cut(s)	148
ZrmI	AGTACT	1 cut(s)	176

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.