RchiOBHm_Chr7g0193521

This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
11817068 .. 11822381
5314 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17305

Sequence Viewer

Length: 267 bp
ATGCTCAAATTTGTTTTCCATTTGTGGAGTGCTCCCCTCACTGATGTTCAGCTATTGTGGGTGAACATGATTATGGACACACTGGGAGCACTTGCACTTGCAATTGGGCCTCCAAATAATGACTTAATGAAGTGTCCGCCAGTTGGAGAGAGGCAAAATTACATCAGTAATGCAATGTGGAGGAATATTTTAGAGCAGTCTTTCTATCAATTTACAATAATATGGCTTCTTAAGGCAATAGGACAAGCAATATTTCATCCTGACTAA

Protein Analysis

88

Amino Acids

10.13

Weight (kDa)

6.01

Isoelectric Point (pI)

39.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cation_ATPase_C PF00689 11 - 85 1.4e-19 Cation transporting ATPase, C-terminus
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 137
AcsI RAATTY 1 cut(s) 8
AfiI CCNNNNNNNGG 1 cut(s) 143
AflII CTTAAG 1 cut(s) 230
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
Alw21I GWGCWC 2 cut(s) 34, 91
AoxI GGCC 1 cut(s) 107
ApoI RAATTY 1 cut(s) 8
AspS9I GGNCC 1 cut(s) 107
AsuHPI GGTGA 1 cut(s) 73
Bbv12I GWGCWC 2 cut(s) 34, 91
BfrI CTTAAG 1 cut(s) 230
BmgT120I GGNCC 1 cut(s) 107
BmrI ACTGGG 1 cut(s) 92
BmuI ACTGGG 1 cut(s) 92
Bsc4I CCNNNNNNNGG 1 cut(s) 143
Bse1I ACTGG 2 cut(s) 87, 140
Bse3DI GCAATG 1 cut(s) 180
BseGI GGATG 1 cut(s) 256
BseLI CCNNNNNNNGG 1 cut(s) 143
BseMI GCAATG 1 cut(s) 180
BseNI ACTGG 2 cut(s) 87, 140
BshFI GGCC 1 cut(s) 109
BsiHKAI GWGCWC 2 cut(s) 34, 91
BslI CCNNNNNNNGG 1 cut(s) 143
BsnI GGCC 1 cut(s) 109
Bsp1286I GDGCHC 2 cut(s) 34, 91
BspACI CCGC 1 cut(s) 137
BspANI GGCC 1 cut(s) 109
BspTI CTTAAG 1 cut(s) 230
BsrDI GCAATG 1 cut(s) 180
BsrI ACTGG 2 cut(s) 87, 140
BstAFI CTTAAG 1 cut(s) 230
BstF5I GGATG 1 cut(s) 256
BsuRI GGCC 1 cut(s) 109
BtsCI GGATG 1 cut(s) 256
BtsIMutI CAGTG 2 cut(s) 39, 80
Cfr13I GGNCC 1 cut(s) 107
CviAII CATG 1 cut(s) 67
CviJI RGCY 3 cut(s) 52, 109, 226
CviKI_1 RGCY 3 cut(s) 52, 109, 226
EciI GGCGGA 1 cut(s) 126
FaeI CATG 1 cut(s) 70
FaiI YATR 3 cut(s) 68, 74, 223
FatI CATG 1 cut(s) 66
FokI GGATG 1 cut(s) 243
HaeIII GGCC 1 cut(s) 109
Hin1II CATG 1 cut(s) 70
HphI GGTGA 1 cut(s) 73
Hpy166II GTNNAC 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 260
Hpy8I GTNNAC 1 cut(s) 64
HpyCH4V TGCA 3 cut(s) 95, 101, 173
Hsp92II CATG 1 cut(s) 70
LmnI GCTCC 2 cut(s) 37, 86
LpnPI CCDG 2 cut(s) 68, 153
MfeI CAATTG 1 cut(s) 102
MhlI GDGCHC 2 cut(s) 34, 91
MluCI AATT 4 cut(s) 8, 102, 157, 209
MmeI TCCRAC 1 cut(s) 124
MnlI CCTC 4 cut(s) 47, 120, 144, 174
MseI TTAA 2 cut(s) 125, 231
MslI CAYNNNNRTG 1 cut(s) 71
MspCI CTTAAG 1 cut(s) 230
MunI CAATTG 1 cut(s) 102
NlaIII CATG 1 cut(s) 70
PspPI GGNCC 1 cut(s) 107
RseI CAYNNNNRTG 1 cut(s) 71
SaqAI TTAA 2 cut(s) 125, 231
Sau96I GGNCC 1 cut(s) 107
SduI GDGCHC 2 cut(s) 34, 91
SetI ASST 1 cut(s) 54
SgeI CNNG 6 cut(s) 79, 95, 104, 110, 152, 257
SmiMI CAYNNNNRTG 1 cut(s) 71
SmlI CTYRAG 1 cut(s) 230
SmoI CTYRAG 1 cut(s) 230
Sse9I AATT 4 cut(s) 8, 102, 157, 209
SsiI CCGC 1 cut(s) 137
SspI AATATT 2 cut(s) 187, 252
TasI AATT 4 cut(s) 8, 102, 157, 209
Tru1I TTAA 2 cut(s) 125, 231
Tru9I TTAA 2 cut(s) 125, 231
TscAI CASTG 2 cut(s) 46, 87
TspDTI ATGAA 2 cut(s) 143, 245
TspRI CASTG 2 cut(s) 46, 87
Vha464I CTTAAG 1 cut(s) 230
XapI RAATTY 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.