RchiOBHm_Chr7g0212191

MIP18 family protein At1g68310-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
29501608 .. 29503944
2337 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18986

Sequence Viewer

Length: 150 bp
ATGGTATCTGAGTTAATAAATGCGAATCCAGTCATCTATGAAAAGAAAGAGCGGCGGGTTCGTAGTGTTCCAAGTGCTGCAGATGAATATGCTGTTGAACCAATTGACCAAGAGGAAATTTTTGATATCCTTTCTGATGATTGTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.63

Weight (kDa)

4.2

Isoelectric Point (pI)

72.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 52
AciI CCGC 2 cut(s) 52, 55
AcsI RAATTY 1 cut(s) 117
AgsI TTSAA 1 cut(s) 98
ApeKI GCWGC 1 cut(s) 77
ApoI RAATTY 1 cut(s) 117
BbvI GCAGC 1 cut(s) 64
BfmI CTRYAG 1 cut(s) 78
BisI GCNGC 2 cut(s) 53, 78
BlsI GCNGC 2 cut(s) 54, 79
Bse1I ACTGG 1 cut(s) 29
BseNI ACTGG 1 cut(s) 29
BseXI GCAGC 1 cut(s) 64
BspACI CCGC 2 cut(s) 52, 55
BspMAI CTGCAG 1 cut(s) 82
BsrBI CCGCTC 1 cut(s) 52
BsrI ACTGG 1 cut(s) 29
BstDEI CTNAG 1 cut(s) 9
BstSFI CTRYAG 1 cut(s) 78
BstV1I GCAGC 1 cut(s) 64
DdeI CTNAG 1 cut(s) 9
Eco32I GATATC 1 cut(s) 127
EcoRV GATATC 1 cut(s) 127
FaiI YATR 2 cut(s) 39, 90
FauI CCCGC 1 cut(s) 48
Fnu4HI GCNGC 2 cut(s) 53, 78
Fsp4HI GCNGC 2 cut(s) 53, 78
FspEI CC 9 cut(s) 37, 40, 41, 42, 84, 98, 114, 122, 143
GluI GCNGC 2 cut(s) 53, 78
HinfI GANTC 1 cut(s) 25
Hpy188I TCNGA 2 cut(s) 10, 136
HpyCH4V TGCA 1 cut(s) 80
HpyF3I CTNAG 1 cut(s) 9
LpnPI CCDG 1 cut(s) 42
Lsp1109I GCAGC 1 cut(s) 64
MbiI CCGCTC 1 cut(s) 52
MfeI CAATTG 1 cut(s) 102
MluCI AATT 2 cut(s) 102, 117
MnlI CCTC 1 cut(s) 106
MseI TTAA 1 cut(s) 14
MunI CAATTG 1 cut(s) 102
PfeI GAWTC 1 cut(s) 25
PkrI GCNGC 2 cut(s) 54, 79
PstI CTGCAG 1 cut(s) 82
SaqAI TTAA 1 cut(s) 14
SatI GCNGC 2 cut(s) 53, 78
SfcI CTRYAG 1 cut(s) 78
SgeI CNNG 4 cut(s) 41, 68, 84, 122
Sse9I AATT 2 cut(s) 102, 117
SsiI CCGC 2 cut(s) 52, 55
TasI AATT 2 cut(s) 102, 117
TauI GCSGC 1 cut(s) 55
TfiI GAWTC 1 cut(s) 25
Tru1I TTAA 1 cut(s) 14
Tru9I TTAA 1 cut(s) 14
TseI GCWGC 1 cut(s) 77
TspDTI ATGAA 2 cut(s) 54, 99
XapI RAATTY 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.