RLG00000006131

Heavy metal-associated isoprenylated plant protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
Physical Location & Seq
Reverse (-)
4672661 .. 4673791
1131 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000006131

Sequence Viewer

Length: 438 bp
ATGGGTGCTCTAGACACTCTATCAGACTATTTCACAATGAGCTCCAAACCCAGAAAGAGACGAAAGCCAATGCAGACAGTTGAAATCAAGGTGAAAATGGACTGTGATGGCTGTGAAAGGAGAGTTAAGAGTGCAGTCTCTAACATGAAAGGTGCAAAACAAGTCGAAGTGAACAGAAAGCAAAGCCGGGTGACGGTGACAGGTTATGTGGAGCCAAACAAGGTGTTAAAGAAGGTGAAGAGCACCGGAAAGAAAGCAGAGATTTGGCCCTACGTTCCATACAACCTCGTTGCTTATCCTTACGTTGCCGGAGCTTATGACAAGAAGGCACCGTCGGGTTACGTCAGAAACGTAGCTCAGGCGGTTTCTAGTCCGCCGGACGACAAGTACACCTCCATGTTCAGCGATGAGAATCCTCACGCTTGCGCCATCATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

146

Amino Acids

16.23

Weight (kDa)

9.66

Isoelectric Point (pI)

40.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HMA PF00403 30 - 85 2.1e-14 Heavy-metal-associated domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 328
AciI CCGC 2 cut(s) 362, 374
AfaI GTAC 1 cut(s) 389
AfiI CCNNNNNNNGG 1 cut(s) 193
AgsI TTSAA 1 cut(s) 83
AluBI AGCT 3 cut(s) 42, 314, 356
AluI AGCT 3 cut(s) 42, 314, 356
Alw21I GWGCWC 3 cut(s) 10, 44, 245
Alw26I GTCTC 2 cut(s) 52, 142
AoxI GGCC 1 cut(s) 266
AspLEI GCGC 1 cut(s) 428
AspS9I GGNCC 1 cut(s) 267
AsuC2I CCSGG 1 cut(s) 188
AsuHPI GGTGA 4 cut(s) 103, 202, 208, 247
BanI GGYRCC 1 cut(s) 328
BanII GRGCYC 1 cut(s) 44
Bbv12I GWGCWC 3 cut(s) 10, 44, 245
BccI CCATC 2 cut(s) 101, 437
BcnI CCSGG 1 cut(s) 188
BcoDI GTCTC 2 cut(s) 52, 142
BfaI CTAG 2 cut(s) 11, 369
Bme1390I CCNGG 1 cut(s) 188
BmgT120I GGNCC 1 cut(s) 267
BmiI GGNNCC 2 cut(s) 213, 330
BmrFI CCNGG 1 cut(s) 188
Bpu10I CCTNAGC 1 cut(s) 357
BpuMI CCSGG 1 cut(s) 188
BsaBI GATNNNNATC 1 cut(s) 411
BsaWI WCCGGW 1 cut(s) 245
Bsc4I CCNNNNNNNGG 1 cut(s) 193
Bse8I GATNNNNATC 1 cut(s) 411
BseJI GATNNNNATC 1 cut(s) 411
BseLI CCNNNNNNNGG 1 cut(s) 193
BseMII CTCAG 1 cut(s) 371
BsgI GTGCAG 1 cut(s) 153
BshFI GGCC 1 cut(s) 268
BshNI GGYRCC 1 cut(s) 328
BsiHKAI GWGCWC 3 cut(s) 10, 44, 245
BsiSI CCGG 4 cut(s) 187, 246, 309, 377
BslI CCNNNNNNNGG 1 cut(s) 193
BsmAI GTCTC 2 cut(s) 52, 142
BsmBI CGTCTC 1 cut(s) 52
BsnI GGCC 1 cut(s) 268
Bsp1286I GDGCHC 3 cut(s) 10, 44, 245
BspACI CCGC 2 cut(s) 362, 374
BspANI GGCC 1 cut(s) 268
BspCNI CTCAG 1 cut(s) 370
BspLI GGNNCC 2 cut(s) 213, 330
BspQI GCTCTTC 1 cut(s) 233
BspT107I GGYRCC 1 cut(s) 328
Bst4CI ACNGT 4 cut(s) 79, 104, 196, 333
Bst6I CTCTTC 1 cut(s) 233
BstC8I GCNNGC 1 cut(s) 424
BstDEI CTNAG 1 cut(s) 357
BstHHI GCGC 1 cut(s) 428
BstMAI GTCTC 2 cut(s) 52, 142
BstSCI CCNGG 1 cut(s) 186
BsuRI GGCC 1 cut(s) 268
BtgZI GCGATG 1 cut(s) 420
Cac8I GCNNGC 1 cut(s) 424
CfoI GCGC 1 cut(s) 428
Cfr13I GGNCC 1 cut(s) 267
Csp6I GTAC 1 cut(s) 388
CviAII CATG 3 cut(s) 145, 397, 433
CviJI RGCY 8 cut(s) 42, 67, 111, 186, 214, 268, 314, 356
CviKI_1 RGCY 8 cut(s) 42, 67, 111, 186, 214, 268, 314, 356
CviQI GTAC 1 cut(s) 388
DdeI CTNAG 1 cut(s) 357
Eam1104I CTCTTC 1 cut(s) 233
EarI CTCTTC 1 cut(s) 233
EciI GGCGGA 1 cut(s) 363
Ecl136II GAGCTC 1 cut(s) 42
Eco24I GRGCYC 1 cut(s) 44
Eco53kI GAGCTC 1 cut(s) 42
EcoICRI GAGCTC 1 cut(s) 42
EcoT38I GRGCYC 1 cut(s) 44
Esp3I CGTCTC 1 cut(s) 52
FaeI CATG 3 cut(s) 148, 400, 436
FaiI YATR 6 cut(s) 146, 207, 280, 318, 398, 434
FatI CATG 3 cut(s) 144, 396, 432
FriOI GRGCYC 1 cut(s) 44
FspBI CTAG 2 cut(s) 11, 369
GlaI GCGC 1 cut(s) 427
HaeIII GGCC 1 cut(s) 268
HapII CCGG 4 cut(s) 187, 246, 309, 377
HhaI GCGC 1 cut(s) 428
Hin1II CATG 3 cut(s) 148, 400, 436
Hin6I GCGC 1 cut(s) 426
HinP1I GCGC 1 cut(s) 426
HinfI GANTC 1 cut(s) 412
HpaII CCGG 4 cut(s) 187, 246, 309, 377
HphI GGTGA 4 cut(s) 103, 202, 208, 247
Hpy166II GTNNAC 2 cut(s) 172, 390
Hpy188I TCNGA 2 cut(s) 25, 347
Hpy188III TCNNGA 1 cut(s) 11
Hpy8I GTNNAC 2 cut(s) 172, 390
Hpy99I CGWCG 1 cut(s) 337
HpyAV CCTTC 2 cut(s) 226, 319
HpyCH4III ACNGT 4 cut(s) 79, 104, 196, 333
HpyCH4IV ACGT 4 cut(s) 273, 303, 342, 351
HpyCH4V TGCA 3 cut(s) 73, 134, 155
HpyF3I CTNAG 1 cut(s) 357
HpySE526I ACGT 4 cut(s) 273, 303, 342, 351
Hsp92II CATG 3 cut(s) 148, 400, 436
HspAI GCGC 1 cut(s) 426
LguI GCTCTTC 1 cut(s) 233
LmnI GCTCC 3 cut(s) 47, 211, 311
LpnPI CCDG 7 cut(s) 64, 186, 200, 259, 322, 344, 390
MaeI CTAG 2 cut(s) 11, 369
MaeII ACGT 4 cut(s) 273, 303, 342, 351
MaeIII GTNAC 3 cut(s) 190, 196, 338
MboII GAAGA 1 cut(s) 250
MhlI GDGCHC 3 cut(s) 10, 44, 245
MnlI CCTC 3 cut(s) 296, 403, 426
MseI TTAA 2 cut(s) 126, 227
MslI CAYNNNNRTG 1 cut(s) 395
MspI CCGG 4 cut(s) 187, 246, 309, 377
MspR9I CCNGG 1 cut(s) 188
NciI CCSGG 1 cut(s) 188
NlaIII CATG 3 cut(s) 148, 400, 436
NlaIV GGNNCC 2 cut(s) 213, 330
NmuCI GTSAC 2 cut(s) 190, 196
PciSI GCTCTTC 1 cut(s) 233
PcsI WCGNNNNNNNCGW 1 cut(s) 348
PfeI GAWTC 1 cut(s) 412
Psp124BI GAGCTC 1 cut(s) 44
PspN4I GGNNCC 2 cut(s) 213, 330
PspPI GGNCC 1 cut(s) 267
RsaI GTAC 1 cut(s) 389
RsaNI GTAC 1 cut(s) 388
RseI CAYNNNNRTG 1 cut(s) 395
SacI GAGCTC 1 cut(s) 44
SapI GCTCTTC 1 cut(s) 233
SaqAI TTAA 2 cut(s) 126, 227
Sau96I GGNCC 1 cut(s) 267
ScrFI CCNGG 1 cut(s) 188
SduI GDGCHC 3 cut(s) 10, 44, 245
SmiMI CAYNNNNRTG 1 cut(s) 395
SsiI CCGC 2 cut(s) 362, 374
SspMI CTAG 2 cut(s) 11, 369
SstI GAGCTC 1 cut(s) 44
StyD4I CCNGG 1 cut(s) 186
TaaI ACNGT 4 cut(s) 79, 104, 196, 333
TaiI ACGT 4 cut(s) 276, 306, 345, 354
TaqI TCGA 1 cut(s) 165
TatI WGTACW 1 cut(s) 387
TfiI GAWTC 1 cut(s) 412
Tru1I TTAA 2 cut(s) 126, 227
Tru9I TTAA 2 cut(s) 126, 227
TseFI GTSAC 2 cut(s) 190, 196
Tsp45I GTSAC 2 cut(s) 190, 196
TspDTI ATGAA 1 cut(s) 161
XbaI TCTAGA 1 cut(s) 10
XspI CTAG 2 cut(s) 11, 369
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.