RLG00000024153

Cactus-binding C-terminus of cactin protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
Physical Location & Seq
Forward (+)
32539098 .. 32539651
554 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000024153

Sequence Viewer

Length: 468 bp
ATGCTTTGGATCGAGCTAGGGTTCGTTGGGAGGAACCTCCTGCCAAGTTACTTGCTGAACAAAGAGGCTTGCATTCTAGCATTGAAGCAGACTTCAGGTATCTCTTGGAAGAGAAGAATTCAGTTGGAGGCATTACACGCTGAAATTGAGTCACAGATGCGTTCTGGTACAGCCAAGGTTGTTGGGTATTGGGAGGCTGTTCTTAGACGCCTCCATGTATTCAAGGCCAAGGCCTGTTTGAAAGAAATCCATGCTAAAATGTCGCACAAGCGTCTGCAACACCTTGAGGGGCGAGAGGATGGTGAAGAGAAATTGGATATGCCCGATGATTTACAACCTGAAGAGGAGAGTGAGCCTGATGCTACGTTAATAGGAACACAAGCGTACGGCTTTATTAGAACAACAACAACCACGAATTCAAGAAGCTATGGCATCAAATCCAGCTCCACAACCAGAAGATTAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

156

Amino Acids

17.66

Weight (kDa)

8.91

Isoelectric Point (pI)

77.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cactin_mid PF10312 37 - 84 1.6e-11 Conserved mid region of cactin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 17
AcsI RAATTY 2 cut(s) 117, 415
AcuI CTGAAG 2 cut(s) 78, 360
AcyI GRCGYC 1 cut(s) 208
AfaI GTAC 2 cut(s) 169, 386
AgsI TTSAA 4 cut(s) 85, 223, 241, 420
AluBI AGCT 3 cut(s) 16, 426, 444
AluI AGCT 3 cut(s) 16, 426, 444
AlwI GGATC 1 cut(s) 17
AoxI GGCC 2 cut(s) 225, 231
ApoI RAATTY 2 cut(s) 117, 415
AsuHPI GGTGA 1 cut(s) 314
BccI CCATC 1 cut(s) 293
BceAI ACGGC 1 cut(s) 403
BfaI CTAG 2 cut(s) 17, 77
BmiI GGNNCC 1 cut(s) 35
BmsI GCATC 3 cut(s) 147, 349, 441
BpuEI CTTGAG 1 cut(s) 305
BsaHI GRCGYC 1 cut(s) 208
BsaJI CCNNGG 2 cut(s) 174, 228
BseDI CCNNGG 2 cut(s) 174, 228
BseGI GGATG 1 cut(s) 304
BseRI GAGGAG 1 cut(s) 359
BshFI GGCC 2 cut(s) 227, 233
BsiWI CGTACG 1 cut(s) 384
BsmI GAATGC 1 cut(s) 72
BsnI GGCC 2 cut(s) 227, 233
Bsp143I GATC 1 cut(s) 9
BspANI GGCC 2 cut(s) 227, 233
BspLI GGNNCC 1 cut(s) 35
BspPI GGATC 1 cut(s) 17
BssECI CCNNGG 2 cut(s) 174, 228
BssMI GATC 1 cut(s) 9
BssNI GRCGYC 1 cut(s) 208
BssT1I CCWWGG 2 cut(s) 174, 228
Bst6I CTCTTC 3 cut(s) 104, 300, 336
BstACI GRCGYC 1 cut(s) 208
BstC8I GCNNGC 1 cut(s) 70
BstDEI CTNAG 1 cut(s) 203
BstF5I GGATG 1 cut(s) 304
BstKTI GATC 1 cut(s) 12
BstMBI GATC 1 cut(s) 9
BstMWI GCNNNNNNNGC 1 cut(s) 137
BsuRI GGCC 2 cut(s) 227, 233
BtsCI GGATG 1 cut(s) 304
Cac8I GCNNGC 1 cut(s) 70
CseI GACGC 2 cut(s) 216, 260
Csp6I GTAC 2 cut(s) 168, 385
CviAII CATG 2 cut(s) 215, 251
CviQI GTAC 2 cut(s) 168, 385
DdeI CTNAG 1 cut(s) 203
DpnI GATC 1 cut(s) 11
DpnII GATC 1 cut(s) 9
Eam1104I CTCTTC 3 cut(s) 104, 300, 336
EarI CTCTTC 3 cut(s) 104, 300, 336
Eco130I CCWWGG 2 cut(s) 174, 228
Eco147I AGGCCT 1 cut(s) 233
Eco57I CTGAAG 2 cut(s) 78, 360
EcoRI GAATTC 2 cut(s) 117, 415
EcoT14I CCWWGG 2 cut(s) 174, 228
ErhI CCWWGG 2 cut(s) 174, 228
FaeI CATG 2 cut(s) 218, 254
FaiI YATR 4 cut(s) 216, 252, 320, 429
FatI CATG 2 cut(s) 214, 250
FokI GGATG 1 cut(s) 311
FspBI CTAG 2 cut(s) 17, 77
HaeIII GGCC 2 cut(s) 227, 233
HgaI GACGC 2 cut(s) 216, 260
Hin1I GRCGYC 1 cut(s) 208
Hin1II CATG 2 cut(s) 218, 254
HinfI GANTC 1 cut(s) 149
HphI GGTGA 1 cut(s) 314
Hpy188III TCNNGA 1 cut(s) 420
HpyCH4IV ACGT 1 cut(s) 365
HpyCH4V TGCA 2 cut(s) 72, 277
HpyF10VI GCNNNNNNNGC 1 cut(s) 137
HpyF3I CTNAG 1 cut(s) 203
HpySE526I ACGT 1 cut(s) 365
Hsp92I GRCGYC 1 cut(s) 208
Hsp92II CATG 2 cut(s) 218, 254
Kzo9I GATC 1 cut(s) 9
LmnI GCTCC 1 cut(s) 449
LpnPI CCDG 7 cut(s) 53, 81, 150, 247, 351, 369, 454
LweI GCATC 3 cut(s) 147, 349, 441
MaeI CTAG 2 cut(s) 17, 77
MaeII ACGT 1 cut(s) 365
MaeIII GTNAC 2 cut(s) 47, 150
MalI GATC 1 cut(s) 11
MboI GATC 1 cut(s) 9
MboII GAAGA 5 cut(s) 121, 126, 317, 353, 468
MluCI AATT 4 cut(s) 117, 144, 311, 415
MlyI GAGTC 1 cut(s) 158
MmeI TCCRAC 1 cut(s) 105
MnlI CCTC 9 cut(s) 24, 47, 58, 121, 187, 221, 280, 289, 337
MseI TTAA 1 cut(s) 368
Mva1269I GAATGC 1 cut(s) 72
MwoI GCNNNNNNNGC 1 cut(s) 137
NdeII GATC 1 cut(s) 9
NlaIII CATG 2 cut(s) 218, 254
NlaIV GGNNCC 1 cut(s) 35
NmuCI GTSAC 1 cut(s) 150
PceI AGGCCT 1 cut(s) 233
PctI GAATGC 1 cut(s) 72
Pfl23II CGTACG 1 cut(s) 384
PleI GAGTC 1 cut(s) 157
PpsI GAGTC 1 cut(s) 157
PspLI CGTACG 1 cut(s) 384
PspN4I GGNNCC 1 cut(s) 35
RsaI GTAC 2 cut(s) 169, 386
RsaNI GTAC 2 cut(s) 168, 385
SaqAI TTAA 1 cut(s) 368
Sau3AI GATC 1 cut(s) 9
SchI GAGTC 1 cut(s) 158
SetI ASST 9 cut(s) 18, 39, 100, 180, 285, 340, 368, 428, 446
SfaNI GCATC 3 cut(s) 147, 349, 441
SmlI CTYRAG 1 cut(s) 284
SmoI CTYRAG 1 cut(s) 284
Sse9I AATT 4 cut(s) 117, 144, 311, 415
SseBI AGGCCT 1 cut(s) 233
SspMI CTAG 2 cut(s) 17, 77
StuI AGGCCT 1 cut(s) 233
StyI CCWWGG 2 cut(s) 174, 228
TaiI ACGT 1 cut(s) 368
TaqI TCGA 1 cut(s) 12
TasI AATT 4 cut(s) 117, 144, 311, 415
Tru1I TTAA 1 cut(s) 368
Tru9I TTAA 1 cut(s) 368
TseFI GTSAC 1 cut(s) 150
Tsp45I GTSAC 1 cut(s) 150
XapI RAATTY 2 cut(s) 117, 415
XspI CTAG 2 cut(s) 17, 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.