RLG00000029711

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
OG0012691
Physical Location & Seq
Reverse (-)
43863558 .. 43863977
420 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000029711

Sequence Viewer

Length: 420 bp
ATGGTGGATGGGGTTATACTAACATGTGTTGACTTTTATTTAGAAGTGGCGAGAGGCAAACTCTGCTGGTTTCTCTTTGCTAGTTATATGTTATTCTTTTTCCTGTGGTGGCGCCTAATATCAAAGAGGCAACAAAAACTAGAGGGGCCTCCCCAAGCAGTAGAGTTCGGAGCTGGATTTGTGAAGATGCTGTGCATAATTGTCCTCAAAGCGGTGCTGCTAAAGAAACTGTTAGAGAAGGACAGTCTTACCTATCATGGTGTGAAATGCTTATTTTATGTTGGTGCCAGAACATGTAGTTCCTATGCGATGCTTTTAGTTACCCTGGAAAAGCTGGAGAAGGAGGACCAATTGATTGTGGAAGGTATGAACAAGCTTAAGAGACAAATAGCAAATGTGGAGCTGGAAATCATCTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

140

Amino Acids

16.04

Weight (kDa)

8.8

Isoelectric Point (pI)

33.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 111, 284
AciI CCGC 1 cut(s) 212
AcyI GRCGYC 1 cut(s) 112
AfiI CCNNNNNNNGG 1 cut(s) 211
AflII CTTAAG 1 cut(s) 377
AflIII ACRYGT 2 cut(s) 23, 293
AjnI CCWGG 1 cut(s) 324
AluBI AGCT 4 cut(s) 173, 334, 376, 403
AluI AGCT 4 cut(s) 173, 334, 376, 403
Alw26I GTCTC 1 cut(s) 376
AoxI GGCC 1 cut(s) 146
ApeKI GCWGC 1 cut(s) 217
AspLEI GCGC 1 cut(s) 114
AspS9I GGNCC 2 cut(s) 146, 346
AvaII GGWCC 1 cut(s) 346
BanI GGYRCC 2 cut(s) 111, 284
BbvI GCAGC 1 cut(s) 204
BccI CCATC 1 cut(s) 2
BciT130I CCWGG 1 cut(s) 326
BcoDI GTCTC 1 cut(s) 376
BfaI CTAG 2 cut(s) 81, 140
BfoI RGCGCY 1 cut(s) 115
BfrI CTTAAG 1 cut(s) 377
BisI GCNGC 1 cut(s) 218
BlsI GCNGC 1 cut(s) 219
Bme1390I CCNGG 1 cut(s) 326
Bme18I GGWCC 1 cut(s) 346
BmgT120I GGNCC 2 cut(s) 146, 346
BmiI GGNNCC 3 cut(s) 113, 147, 286
BmrFI CCNGG 1 cut(s) 326
BmsI GCATC 2 cut(s) 177, 300
BplI GAGNNNNNCTC 2 cut(s) 45, 77
BpmI CTGGAG 1 cut(s) 356
BsaHI GRCGYC 1 cut(s) 112
BsaJI CCNNGG 1 cut(s) 324
Bsc4I CCNNNNNNNGG 1 cut(s) 211
BseBI CCWGG 1 cut(s) 326
BseDI CCNNGG 1 cut(s) 324
BseGI GGATG 1 cut(s) 13
BseLI CCNNNNNNNGG 1 cut(s) 211
BseXI GCAGC 1 cut(s) 204
BshFI GGCC 1 cut(s) 148
BshNI GGYRCC 2 cut(s) 111, 284
BslI CCNNNNNNNGG 1 cut(s) 211
BsmAI GTCTC 1 cut(s) 376
BsnI GGCC 1 cut(s) 148
BspACI CCGC 1 cut(s) 212
BspANI GGCC 1 cut(s) 148
BspLI GGNNCC 3 cut(s) 113, 147, 286
BspT107I GGYRCC 2 cut(s) 111, 284
BspTI CTTAAG 1 cut(s) 377
BssECI CCNNGG 1 cut(s) 324
BssNI GRCGYC 1 cut(s) 112
Bst2UI CCWGG 1 cut(s) 326
Bst4CI ACNGT 2 cut(s) 231, 245
BstACI GRCGYC 1 cut(s) 112
BstAFI CTTAAG 1 cut(s) 377
BstAPI GCANNNNNTGC 1 cut(s) 63
BstF5I GGATG 1 cut(s) 13
BstH2I RGCGCY 1 cut(s) 115
BstHHI GCGC 1 cut(s) 114
BstMAI GTCTC 1 cut(s) 376
BstMWI GCNNNNNNNGC 1 cut(s) 63
BstNI CCWGG 1 cut(s) 326
BstNSI RCATGY 2 cut(s) 27, 297
BstSCI CCNGG 1 cut(s) 324
BstV1I GCAGC 1 cut(s) 204
BsuRI GGCC 1 cut(s) 148
BtgZI GCGATG 1 cut(s) 323
BtsCI GGATG 1 cut(s) 13
CfoI GCGC 1 cut(s) 114
Cfr13I GGNCC 2 cut(s) 146, 346
CviAII CATG 3 cut(s) 24, 257, 294
CviJI RGCY 5 cut(s) 148, 173, 334, 376, 403
CviKI_1 RGCY 5 cut(s) 148, 173, 334, 376, 403
DinI GGCGCC 1 cut(s) 113
Eco47I GGWCC 1 cut(s) 346
EcoO109I RGGNCCY 1 cut(s) 146
EcoRII CCWGG 1 cut(s) 324
EgeI GGCGCC 1 cut(s) 113
EheI GGCGCC 1 cut(s) 113
FaeI CATG 3 cut(s) 27, 260, 297
FatI CATG 3 cut(s) 23, 256, 293
Fnu4HI GCNGC 1 cut(s) 218
FokI GGATG 1 cut(s) 20
Fsp4HI GCNGC 1 cut(s) 218
FspBI CTAG 2 cut(s) 81, 140
GlaI GCGC 1 cut(s) 113
GluI GCNGC 1 cut(s) 218
GsuI CTGGAG 1 cut(s) 356
HaeII RGCGCY 1 cut(s) 115
HaeIII GGCC 1 cut(s) 148
HhaI GCGC 1 cut(s) 114
Hin1I GRCGYC 1 cut(s) 112
Hin1II CATG 3 cut(s) 27, 260, 297
Hin6I GCGC 1 cut(s) 112
HinP1I GCGC 1 cut(s) 112
HincII GTYRAC 1 cut(s) 31
HindII GTYRAC 1 cut(s) 31
HindIII AAGCTT 1 cut(s) 374
Hpy166II GTNNAC 1 cut(s) 31
Hpy188I TCNGA 1 cut(s) 170
Hpy8I GTNNAC 1 cut(s) 31
HpyAV CCTTC 3 cut(s) 232, 334, 356
HpyCH4III ACNGT 2 cut(s) 231, 245
HpyCH4V TGCA 1 cut(s) 195
HpyF10VI GCNNNNNNNGC 1 cut(s) 63
Hsp92I GRCGYC 1 cut(s) 112
Hsp92II CATG 3 cut(s) 27, 260, 297
HspAI GCGC 1 cut(s) 112
KasI GGCGCC 1 cut(s) 111
LmnI GCTCC 2 cut(s) 170, 400
LpnPI CCDG 8 cut(s) 52, 116, 159, 301, 311, 320, 338, 389
Lsp1109I GCAGC 1 cut(s) 204
LweI GCATC 2 cut(s) 177, 300
MaeI CTAG 2 cut(s) 81, 140
MaeIII GTNAC 1 cut(s) 319
MboII GAAGA 1 cut(s) 196
MfeI CAATTG 1 cut(s) 350
MluCI AATT 2 cut(s) 198, 350
Mly113I GGCGCC 1 cut(s) 112
MnlI CCTC 6 cut(s) 47, 120, 136, 159, 215, 337
MseI TTAA 1 cut(s) 378
MspCI CTTAAG 1 cut(s) 377
MspR9I CCNGG 1 cut(s) 326
MunI CAATTG 1 cut(s) 350
MvaI CCWGG 1 cut(s) 326
MwoI GCNNNNNNNGC 1 cut(s) 63
NarI GGCGCC 1 cut(s) 112
NlaIII CATG 3 cut(s) 27, 260, 297
NlaIV GGNNCC 3 cut(s) 113, 147, 286
NspI RCATGY 2 cut(s) 27, 297
PciI ACATGT 2 cut(s) 23, 293
PkrI GCNGC 1 cut(s) 219
PluTI GGCGCC 1 cut(s) 115
PscI ACATGT 2 cut(s) 23, 293
Psp6I CCWGG 1 cut(s) 324
PspGI CCWGG 1 cut(s) 324
PspN4I GGNNCC 3 cut(s) 113, 147, 286
PspPI GGNCC 2 cut(s) 146, 346
SaqAI TTAA 1 cut(s) 378
SatI GCNGC 1 cut(s) 218
Sau96I GGNCC 2 cut(s) 146, 346
ScrFI CCNGG 1 cut(s) 326
SetI ASST 6 cut(s) 175, 254, 336, 367, 378, 405
SfaNI GCATC 2 cut(s) 177, 300
SfoI GGCGCC 1 cut(s) 113
SinI GGWCC 1 cut(s) 346
SmlI CTYRAG 1 cut(s) 377
SmoI CTYRAG 1 cut(s) 377
Sse9I AATT 2 cut(s) 198, 350
SsiI CCGC 1 cut(s) 212
SspDI GGCGCC 1 cut(s) 111
SspMI CTAG 2 cut(s) 81, 140
StyD4I CCNGG 1 cut(s) 324
TaaI ACNGT 2 cut(s) 231, 245
TasI AATT 2 cut(s) 198, 350
Tru1I TTAA 1 cut(s) 378
Tru9I TTAA 1 cut(s) 378
TseI GCWGC 1 cut(s) 217
TspDTI ATGAA 1 cut(s) 383
Vha464I CTTAAG 1 cut(s) 377
VpaK11BI GGWCC 1 cut(s) 346
XceI RCATGY 2 cut(s) 27, 297
XspI CTAG 2 cut(s) 81, 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.