Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8480945.1

Orthogroup ID

OG0012691

Physical Location & Seq

Genomic Coordinates Forward (+)

267 .. 749

Gene Structure 483 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8480945.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 483 bp

atgactagtaaaccgataaatttaggttcgggacgtaacacatacgaatcaagaccaaaatggagggatactcagagggattcaaaaaagaaggaactaggcttggttcgccagcaagaaatgaatgcaaggcgtagggaggaccttttaaatgagaggcgagcactcacacgggcaagcatcaggatggaattacagagggagtgcctgaaagatcagagaataaaatggcataaggacttggatgacctaatggatgaaagacagcaactccggaaacgaaaggcttctttcaagaaactgtggtggatttccatagtggtggacaaagtaattttaacttgcttggatttatacatggaagacgcatgtggcatacgctattggacctcttttgttgcttaccttatactttttttcactatggtggggtataatatccaagagacaatagaagctagaagggcctcaccaggcaattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

160

Amino Acids

19.22

Weight (kDa)

9.83

Isoelectric Point (pI)

58.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012691)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr4g0384821 RchiOBHm_Chr4g0384861
rosa_laevigata	RLG00000010264 RLG00000029711 RLG00000029712
rosa_multiflora	Rmu_co8480945.1_g000001
rosa_roxburghii	Rroxscaffold_5G00332890 Rroxscaffold_5G00332900
rosa_rugosa	Rorug01G0105400
rosa_samantha	Rh1AG126900 Rh1CG120700 Rh1DG131800 Rh1DG131900 Rh4AG002000 Rh4CG001500 Rh4CG001600 Rh4DG001600 Rh7DG319100
rosa_wichuraiana	Rw4G000740

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccIII	TCCGGA	1 cut(s)	273
AcsI	RAATTY	1 cut(s)	19
AgsI	TTSAA	2 cut(s)	84, 295
AhlI	ACTAGT	1 cut(s)	5
AjnI	CCWGG	1 cut(s)	472
AleI	CACNNNNGTG	1 cut(s)	425
AluBI	AGCT	1 cut(s)	458
AluI	AGCT	1 cut(s)	458
Alw21I	GWGCWC	1 cut(s)	166
Alw26I	GTCTC	1 cut(s)	440
Aor13HI	TCCGGA	1 cut(s)	273
AoxI	GGCC	1 cut(s)	465
ApoI	RAATTY	1 cut(s)	19
Asp700I	GAANNNNTTC	1 cut(s)	286
AspS9I	GGNCC	3 cut(s)	142, 387, 465
AsuHPI	GGTGA	1 cut(s)	462
AvaII	GGWCC	2 cut(s)	142, 387
BbsI	GAAGAC	1 cut(s)	369
Bbv12I	GWGCWC	1 cut(s)	166
BccI	CCATC	1 cut(s)	181
BciT130I	CCWGG	1 cut(s)	474
BciVI	GTATCC	1 cut(s)	61
BcoDI	GTCTC	1 cut(s)	440
BcuI	ACTAGT	1 cut(s)	5
BfaI	CTAG	3 cut(s)	6, 98, 459
BfuI	GTATCC	1 cut(s)	61
Bme1390I	CCNGG	1 cut(s)	474
Bme18I	GGWCC	2 cut(s)	142, 387
BmgT120I	GGNCC	3 cut(s)	142, 387, 465
BmrFI	CCNGG	1 cut(s)	474
BmsI	GCATC	1 cut(s)	189
BpiI	GAAGAC	1 cut(s)	369
BplI	GAGNNNNNCTC	2 cut(s)	55, 87
BsaWI	WCCGGW	1 cut(s)	273
BsaXI	ACNNNNNCTCC	2 cut(s)	255, 285
BseAI	TCCGGA	1 cut(s)	273
BseBI	CCWGG	1 cut(s)	474
BseGI	GGATG	3 cut(s)	192, 250, 262
BseMII	CTCAG	1 cut(s)	86
BshFI	GGCC	1 cut(s)	467
BsiHKAI	GWGCWC	1 cut(s)	166
BsiSI	CCGG	1 cut(s)	274
BslFI	GGGAC	1 cut(s)	45
BsmAI	GTCTC	1 cut(s)	440
BsmFI	GGGAC	1 cut(s)	45
BsmI	GAATGC	1 cut(s)	130
BsnI	GGCC	1 cut(s)	467
Bsp1286I	GDGCHC	1 cut(s)	166
Bsp13I	TCCGGA	1 cut(s)	273
Bsp143I	GATC	1 cut(s)	214
BspANI	GGCC	1 cut(s)	467
BspCNI	CTCAG	1 cut(s)	85
BspEI	TCCGGA	1 cut(s)	273
BssMI	GATC	1 cut(s)	214
Bst2UI	CCWGG	1 cut(s)	474
Bst4CI	ACNGT	1 cut(s)	303
BstC8I	GCNNGC	3 cut(s)	113, 162, 178
BstDEI	CTNAG	1 cut(s)	72
BstF5I	GGATG	3 cut(s)	192, 250, 262
BstKTI	GATC	1 cut(s)	217
BstMAI	GTCTC	1 cut(s)	440
BstMBI	GATC	1 cut(s)	214
BstMWI	GCNNNNNNNGC	2 cut(s)	108, 464
BstNI	CCWGG	1 cut(s)	474
BstNSI	RCATGY	1 cut(s)	372
BstSCI	CCNGG	1 cut(s)	472
BstV2I	GAAGAC	1 cut(s)	369
BstXI	CCANNNNNNTGG	1 cut(s)	322
BsuI	GTATCC	1 cut(s)	61
BsuRI	GGCC	1 cut(s)	467
BtsCI	GGATG	3 cut(s)	192, 250, 262
Cac8I	GCNNGC	3 cut(s)	113, 162, 178
Cfr13I	GGNCC	3 cut(s)	142, 387, 465
CseI	GACGC	1 cut(s)	374
CviAII	CATG	2 cut(s)	358, 369
CviJI	RGCY	4 cut(s)	102, 287, 458, 467
CviKI_1	RGCY	4 cut(s)	102, 287, 458, 467
DdeI	CTNAG	1 cut(s)	72
DpnI	GATC	1 cut(s)	216
DpnII	GATC	1 cut(s)	214
DraI	TTTAAA	1 cut(s)	150
Eco47I	GGWCC	2 cut(s)	142, 387
EcoO109I	RGGNCCY	2 cut(s)	142, 465
EcoRII	CCWGG	1 cut(s)	472
FaeI	CATG	2 cut(s)	361, 372
FaqI	GGGAC	1 cut(s)	45
FatI	CATG	2 cut(s)	357, 368
FokI	GGATG	3 cut(s)	199, 257, 269
FspBI	CTAG	3 cut(s)	6, 98, 459
HaeIII	GGCC	1 cut(s)	467
HapII	CCGG	1 cut(s)	274
HgaI	GACGC	1 cut(s)	374
Hin1II	CATG	2 cut(s)	361, 372
HinfI	GANTC	2 cut(s)	47, 80
HpaII	CCGG	1 cut(s)	274
HphI	GGTGA	1 cut(s)	462
Hpy166II	GTNNAC	2 cut(s)	11, 325
Hpy188I	TCNGA	2 cut(s)	75, 219
Hpy188III	TCNNGA	5 cut(s)	30, 51, 184, 274, 295
Hpy8I	GTNNAC	2 cut(s)	11, 325
HpyAV	CCTTC	2 cut(s)	85, 456
HpyCH4III	ACNGT	1 cut(s)	303
HpyCH4IV	ACGT	1 cut(s)	34
HpyCH4V	TGCA	1 cut(s)	128
HpyF10VI	GCNNNNNNNGC	2 cut(s)	108, 464
HpyF3I	CTNAG	1 cut(s)	72
HpySE526I	ACGT	1 cut(s)	34
Hsp92II	CATG	2 cut(s)	361, 372
Kpn2I	TCCGGA	1 cut(s)	273
Kzo9I	GATC	1 cut(s)	214
LpnPI	CCDG	5 cut(s)	125, 169, 221, 287, 459
LweI	GCATC	1 cut(s)	189
MaeI	CTAG	3 cut(s)	6, 98, 459
MaeII	ACGT	1 cut(s)	34
MaeIII	GTNAC	1 cut(s)	35
MalI	GATC	1 cut(s)	216
MboI	GATC	1 cut(s)	214
MboII	GAAGA	1 cut(s)	374
MfeI	CAATTG	1 cut(s)	478
MhlI	GDGCHC	1 cut(s)	166
MluCI	AATT	4 cut(s)	19, 191, 333, 478
MnlI	CCTC	7 cut(s)	57, 69, 133, 150, 192, 400, 478
MroI	TCCGGA	1 cut(s)	273
MroXI	GAANNNNTTC	1 cut(s)	286
MseI	TTAA	2 cut(s)	149, 338
MslI	CAYNNNNRTG	3 cut(s)	185, 320, 425
MspI	CCGG	1 cut(s)	274
MspR9I	CCNGG	1 cut(s)	474
MunI	CAATTG	1 cut(s)	478
Mva1269I	GAATGC	1 cut(s)	130
MvaI	CCWGG	1 cut(s)	474
MwoI	GCNNNNNNNGC	2 cut(s)	108, 464
NdeII	GATC	1 cut(s)	214
NlaIII	CATG	2 cut(s)	361, 372
NspI	RCATGY	1 cut(s)	372
OliI	CACNNNNGTG	1 cut(s)	425
PctI	GAATGC	1 cut(s)	130
PdmI	GAANNNNTTC	1 cut(s)	286
PfeI	GAWTC	2 cut(s)	47, 80
PpuMI	RGGWCCY	1 cut(s)	142
Psp5II	RGGWCCY	1 cut(s)	142
Psp6I	CCWGG	1 cut(s)	472
PspGI	CCWGG	1 cut(s)	472
PspPI	GGNCC	3 cut(s)	142, 387, 465
PspPPI	RGGWCCY	1 cut(s)	142
RseI	CAYNNNNRTG	3 cut(s)	185, 320, 425
SaqAI	TTAA	2 cut(s)	149, 338
Sau3AI	GATC	1 cut(s)	214
Sau96I	GGNCC	3 cut(s)	142, 387, 465
ScrFI	CCNGG	1 cut(s)	474
SduI	GDGCHC	1 cut(s)	166
SetI	ASST	7 cut(s)	28, 37, 147, 252, 392, 408, 460
SfaNI	GCATC	1 cut(s)	189
SinI	GGWCC	2 cut(s)	142, 387
SmiMI	CAYNNNNRTG	3 cut(s)	185, 320, 425
SpeI	ACTAGT	1 cut(s)	5
Sse9I	AATT	4 cut(s)	19, 191, 333, 478
SspMI	CTAG	3 cut(s)	6, 98, 459
StyD4I	CCNGG	1 cut(s)	472
TaaI	ACNGT	1 cut(s)	303
TaiI	ACGT	1 cut(s)	37
TasI	AATT	4 cut(s)	19, 191, 333, 478
TfiI	GAWTC	2 cut(s)	47, 80
Tru1I	TTAA	2 cut(s)	149, 338
Tru9I	TTAA	2 cut(s)	149, 338
TspDTI	ATGAA	2 cut(s)	137, 273
VpaK11BI	GGWCC	2 cut(s)	142, 387
XapI	RAATTY	1 cut(s)	19
XceI	RCATGY	1 cut(s)	372
XmnI	GAANNNNTTC	1 cut(s)	286
XspI	CTAG	3 cut(s)	6, 98, 459

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.