Rroxscaffold_5G00332900

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
303702 .. 304502
801 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00332900.1

Sequence Viewer

Length: 243 bp
ATGAAGGGTCTTTGTGTGATTGCCCTCAAGATGGTGTTAATCAACAGATTCAAGAAAGAATCTCTTCTTTATTATGTTGTCAAGTGTTTCTTTTATGTCGGGGCTCAAGGTTTAAGTTCCTACGCTATGTTGCTGCTGACACTTGAGAAGCTGGATAAGGAGGACCTTCAAATTGAACAAACTATGGATAAGCTGATCAGAGAACTAGCCAGCCTAGAGCAAGAAATCTCAGATGATGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.27

Weight (kDa)

4.92

Isoelectric Point (pI)

37.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 31
AgsI TTSAA 3 cut(s) 52, 170, 176
AluBI AGCT 2 cut(s) 151, 193
AluI AGCT 2 cut(s) 151, 193
ApeKI GCWGC 1 cut(s) 133
Asp700I GAANNNNTTC 1 cut(s) 63
AspS9I GGNCC 1 cut(s) 163
AvaII GGWCC 1 cut(s) 163
BanII GRGCYC 1 cut(s) 106
BbvI GCAGC 1 cut(s) 120
BccI CCATC 1 cut(s) 25
BclI TGATCA 1 cut(s) 195
BfaI CTAG 2 cut(s) 206, 215
BisI GCNGC 1 cut(s) 134
BlsI GCNGC 1 cut(s) 135
Bme18I GGWCC 1 cut(s) 163
BmgT120I GGNCC 1 cut(s) 163
BpuEI CTTGAG 3 cut(s) 11, 90, 164
Bsc4I CCNNNNNNNGG 1 cut(s) 31
BseLI CCNNNNNNNGG 1 cut(s) 31
BseMII CTCAG 1 cut(s) 243
BseXI GCAGC 1 cut(s) 120
BslI CCNNNNNNNGG 1 cut(s) 31
Bsp1286I GDGCHC 1 cut(s) 106
Bsp143I GATC 1 cut(s) 195
BspCNI CTCAG 1 cut(s) 242
BssMI GATC 1 cut(s) 195
Bst6I CTCTTC 1 cut(s) 69
BstC8I GCNNGC 1 cut(s) 211
BstDEI CTNAG 1 cut(s) 229
BstKTI GATC 1 cut(s) 198
BstMBI GATC 1 cut(s) 195
BstV1I GCAGC 1 cut(s) 120
Cac8I GCNNGC 1 cut(s) 211
Cfr13I GGNCC 1 cut(s) 163
CviJI RGCY 5 cut(s) 104, 151, 193, 209, 213
CviKI_1 RGCY 5 cut(s) 104, 151, 193, 209, 213
DdeI CTNAG 1 cut(s) 229
DpnI GATC 1 cut(s) 197
DpnII GATC 1 cut(s) 195
Eam1104I CTCTTC 1 cut(s) 69
EarI CTCTTC 1 cut(s) 69
Eco24I GRGCYC 1 cut(s) 106
Eco47I GGWCC 1 cut(s) 163
EcoO109I RGGNCCY 1 cut(s) 163
EcoT38I GRGCYC 1 cut(s) 106
FaiI YATR 4 cut(s) 75, 96, 128, 185
FalI AAGNNNNNCTT 4 cut(s) 48, 80, 74, 106
FbaI TGATCA 1 cut(s) 195
Fnu4HI GCNGC 1 cut(s) 134
FriOI GRGCYC 1 cut(s) 106
Fsp4HI GCNGC 1 cut(s) 134
FspBI CTAG 2 cut(s) 206, 215
GluI GCNGC 1 cut(s) 134
HinfI GANTC 2 cut(s) 48, 59
Hpy188I TCNGA 2 cut(s) 200, 232
Hpy188III TCNNGA 2 cut(s) 28, 52
HpyAV CCTTC 1 cut(s) 176
HpyF3I CTNAG 1 cut(s) 229
Ksp22I TGATCA 1 cut(s) 195
Kzo9I GATC 1 cut(s) 195
LpnPI CCDG 2 cut(s) 137, 223
Lsp1109I GCAGC 1 cut(s) 120
MaeI CTAG 2 cut(s) 206, 215
MalI GATC 1 cut(s) 197
MboI GATC 1 cut(s) 195
MboII GAAGA 1 cut(s) 56
MhlI GDGCHC 1 cut(s) 106
MluCI AATT 1 cut(s) 171
MnlI CCTC 2 cut(s) 35, 154
MroXI GAANNNNTTC 1 cut(s) 63
MseI TTAA 2 cut(s) 38, 113
NdeII GATC 1 cut(s) 195
PdmI GAANNNNTTC 1 cut(s) 63
PfeI GAWTC 2 cut(s) 48, 59
PkrI GCNGC 1 cut(s) 135
PpuMI RGGWCCY 1 cut(s) 163
Psp5II RGGWCCY 1 cut(s) 163
PspPI GGNCC 1 cut(s) 163
PspPPI RGGWCCY 1 cut(s) 163
SaqAI TTAA 2 cut(s) 38, 113
SatI GCNGC 1 cut(s) 134
Sau3AI GATC 1 cut(s) 195
Sau96I GGNCC 1 cut(s) 163
SduI GDGCHC 1 cut(s) 106
SetI ASST 4 cut(s) 112, 153, 168, 195
SinI GGWCC 1 cut(s) 163
SmlI CTYRAG 3 cut(s) 26, 105, 143
SmoI CTYRAG 3 cut(s) 26, 105, 143
Sse9I AATT 1 cut(s) 171
SspMI CTAG 2 cut(s) 206, 215
TasI AATT 1 cut(s) 171
TfiI GAWTC 2 cut(s) 48, 59
Tru1I TTAA 2 cut(s) 38, 113
Tru9I TTAA 2 cut(s) 38, 113
TseI GCWGC 1 cut(s) 133
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 163
XmnI GAANNNNTTC 1 cut(s) 63
XspI CTAG 2 cut(s) 206, 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.