Rmu_co7960401.1_g000001

GDP-L-galactose phosphorylase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7960401.1
Physical Location & Seq
Reverse (-)
2 .. 485
484 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7960401.1_g000001.1.cds

Sequence Viewer

Length: 328 bp
atggcttactacttggctgtaacctttcccattgaaaaggctcctactaagaaaataaccactttggatgttggggtgaagatctctgagcttctgaactatcctgttagaggtctagttcttgagggtggaaatactctggaagatttgtcaaactctgtctctgatgcctgcatttgccttcaagagaacaacattccttacaatgtcctcatatctgactgtggaaagcggatctttctcttgccacagtgttatgctgagaaacaagctcttggggaagttagggcagagcttctggatactcaggtgaatccagctgtgtggg

Protein Analysis

109

Amino Acids

12.03

Weight (kDa)

4.68

Isoelectric Point (pI)

44.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 232
AclWI GGATC 1 cut(s) 242
AfiI CCNNNNNNNGG 1 cut(s) 110
AgsI TTSAA 2 cut(s) 35, 185
AluBI AGCT 4 cut(s) 91, 272, 295, 320
AluI AGCT 4 cut(s) 91, 272, 295, 320
Alw26I GTCTC 1 cut(s) 166
AlwI GGATC 1 cut(s) 242
AsuHPI GGTGA 2 cut(s) 88, 322
BaeI ACNNNNGTAYC 2 cut(s) 294, 327
BciVI GTATCC 1 cut(s) 295
BcoDI GTCTC 1 cut(s) 166
BfaI CTAG 1 cut(s) 116
BfuI GTATCC 1 cut(s) 295
BglII AGATCT 1 cut(s) 81
BmiI GGNNCC 1 cut(s) 42
BmsI GCATC 1 cut(s) 157
BpuEI CTTGAG 1 cut(s) 143
Bsc4I CCNNNNNNNGG 1 cut(s) 110
BseGI GGATG 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 110
BseMII CTCAG 3 cut(s) 78, 252, 320
BslI CCNNNNNNNGG 1 cut(s) 110
BsmAI GTCTC 1 cut(s) 166
Bsp143I GATC 2 cut(s) 81, 234
BspACI CCGC 1 cut(s) 232
BspCNI CTCAG 3 cut(s) 79, 253, 319
BspLI GGNNCC 1 cut(s) 42
BspPI GGATC 1 cut(s) 242
BssMI GATC 2 cut(s) 81, 234
Bst4CI ACNGT 2 cut(s) 224, 252
BstC8I GCNNGC 1 cut(s) 172
BstDEI CTNAG 4 cut(s) 48, 87, 261, 306
BstENI CCTNNNNNAGG 1 cut(s) 108
BstF5I GGATG 1 cut(s) 73
BstKTI GATC 2 cut(s) 84, 237
BstMAI GTCTC 1 cut(s) 166
BstMBI GATC 2 cut(s) 81, 234
BstX2I RGATCY 2 cut(s) 81, 234
BstXI CCANNNNNNTGG 1 cut(s) 324
BstYI RGATCY 2 cut(s) 81, 234
BsuI GTATCC 1 cut(s) 295
BtsCI GGATG 1 cut(s) 73
BtsIMutI CAGTG 1 cut(s) 257
Cac8I GCNNGC 1 cut(s) 172
CviJI RGCY 7 cut(s) 5, 17, 41, 91, 272, 295, 320
CviKI_1 RGCY 7 cut(s) 5, 17, 41, 91, 272, 295, 320
DdeI CTNAG 4 cut(s) 48, 87, 261, 306
DpnI GATC 2 cut(s) 83, 236
DpnII GATC 2 cut(s) 81, 234
EcoNI CCTNNNNNAGG 1 cut(s) 108
FaiI YATR 2 cut(s) 215, 258
FalI AAGNNNNNCTT 2 cut(s) 221, 253
FokI GGATG 1 cut(s) 80
FspBI CTAG 1 cut(s) 116
HinfI GANTC 1 cut(s) 313
HphI GGTGA 2 cut(s) 88, 322
Hpy188I TCNGA 4 cut(s) 88, 96, 166, 220
Hpy188III TCNNGA 4 cut(s) 122, 140, 185, 299
HpyAV CCTTC 1 cut(s) 191
HpyCH4III ACNGT 2 cut(s) 224, 252
HpyCH4V TGCA 1 cut(s) 174
HpyF3I CTNAG 4 cut(s) 48, 87, 261, 306
Kzo9I GATC 2 cut(s) 81, 234
LmnI GCTCC 1 cut(s) 46
LpnPI CCDG 5 cut(s) 117, 125, 184, 284, 293
LweI GCATC 1 cut(s) 157
MaeI CTAG 1 cut(s) 116
MaeIII GTNAC 1 cut(s) 19
MalI GATC 2 cut(s) 83, 236
MboI GATC 2 cut(s) 81, 234
MboII GAAGA 2 cut(s) 91, 155
MflI RGATCY 2 cut(s) 81, 234
MnlI CCTC 3 cut(s) 104, 118, 221
MspA1I CMGCKG 1 cut(s) 320
NdeII GATC 2 cut(s) 81, 234
NlaIV GGNNCC 1 cut(s) 42
PfeI GAWTC 1 cut(s) 313
PspN4I GGNNCC 1 cut(s) 42
PsuI RGATCY 2 cut(s) 81, 234
PvuII CAGCTG 1 cut(s) 320
Sau3AI GATC 2 cut(s) 81, 234
SetI ASST 7 cut(s) 26, 93, 115, 274, 297, 312, 322
SfaNI GCATC 1 cut(s) 157
SmlI CTYRAG 1 cut(s) 122
SmoI CTYRAG 1 cut(s) 122
SsiI CCGC 1 cut(s) 232
SspMI CTAG 1 cut(s) 116
TaaI ACNGT 2 cut(s) 224, 252
TfiI GAWTC 1 cut(s) 313
TscAI CASTG 1 cut(s) 257
TspRI CASTG 1 cut(s) 257
XagI CCTNNNNNAGG 1 cut(s) 108
XspI CTAG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.