Rmu_co7977656.1_g000001

Rhamnogalacturonate lyase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7977656.1
Physical Location & Seq
Reverse (-)
67 .. 392
326 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7977656.1_g000001.1.cds

Sequence Viewer

Length: 243 bp
atggaaggaacaaattttacggttatagtggaaactgaggatcagatagagctttcattcaccagaatgtgggatccctctttagagggcaaagtcgtccctttaaacatagacaaaaggttcgtgttgcttcgtaactcttcgggtttctacacttacgccatttatgaacacttgaaggagtggcctgctttcaacttgaccaacaccaggactgtgtttaagctcagaaaagacaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

9.49

Weight (kDa)

6.57

Isoelectric Point (pI)

30.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 69
AclWI GGATC 3 cut(s) 48, 68, 81
AcsI RAATTY 1 cut(s) 13
AfiI CCNNNNNNNGG 2 cut(s) 69, 210
AgsI TTSAA 2 cut(s) 178, 196
AjnI CCWGG 1 cut(s) 209
AluBI AGCT 2 cut(s) 52, 226
AluI AGCT 2 cut(s) 52, 226
AlwI GGATC 3 cut(s) 48, 68, 81
AoxI GGCC 1 cut(s) 185
ApoI RAATTY 1 cut(s) 13
ArsI GACNNNNNNTTYG 2 cut(s) 104, 136
AsuHPI GGTGA 1 cut(s) 52
BamHI GGATCC 1 cut(s) 73
BciT130I CCWGG 1 cut(s) 211
Bme1390I CCNGG 1 cut(s) 211
BmiI GGNNCC 1 cut(s) 75
BmrFI CCNGG 1 cut(s) 211
Bsc4I CCNNNNNNNGG 2 cut(s) 69, 210
BseBI CCWGG 1 cut(s) 211
BseLI CCNNNNNNNGG 2 cut(s) 69, 210
BseMII CTCAG 2 cut(s) 27, 241
BshFI GGCC 1 cut(s) 187
BslFI GGGAC 1 cut(s) 83
BslI CCNNNNNNNGG 2 cut(s) 69, 210
BsmFI GGGAC 1 cut(s) 83
BsnI GGCC 1 cut(s) 187
Bsp143I GATC 2 cut(s) 40, 73
BspANI GGCC 1 cut(s) 187
BspCNI CTCAG 2 cut(s) 28, 240
BspLI GGNNCC 1 cut(s) 75
BspPI GGATC 3 cut(s) 48, 68, 81
BssMI GATC 2 cut(s) 40, 73
Bst2UI CCWGG 1 cut(s) 211
Bst4CI ACNGT 2 cut(s) 22, 217
Bst6I CTCTTC 1 cut(s) 145
BstC8I GCNNGC 1 cut(s) 189
BstDEI CTNAG 2 cut(s) 36, 227
BstKTI GATC 2 cut(s) 43, 76
BstMBI GATC 2 cut(s) 40, 73
BstNI CCWGG 1 cut(s) 211
BstSCI CCNGG 1 cut(s) 209
BstX2I RGATCY 1 cut(s) 73
BstYI RGATCY 1 cut(s) 73
BsuRI GGCC 1 cut(s) 187
Cac8I GCNNGC 1 cut(s) 189
CviJI RGCY 3 cut(s) 52, 187, 226
CviKI_1 RGCY 3 cut(s) 52, 187, 226
DdeI CTNAG 2 cut(s) 36, 227
DpnI GATC 2 cut(s) 42, 75
DpnII GATC 2 cut(s) 40, 73
DraI TTTAAA 1 cut(s) 105
Eam1104I CTCTTC 1 cut(s) 145
EarI CTCTTC 1 cut(s) 145
EcoRII CCWGG 1 cut(s) 209
FaiI YATR 3 cut(s) 26, 110, 168
FaqI GGGAC 1 cut(s) 83
HaeIII GGCC 1 cut(s) 187
HphI GGTGA 1 cut(s) 52
Hpy188I TCNGA 2 cut(s) 45, 230
HpyAV CCTTC 1 cut(s) 172
HpyCH4III ACNGT 2 cut(s) 22, 217
HpyF3I CTNAG 2 cut(s) 36, 227
Kzo9I GATC 2 cut(s) 40, 73
LpnPI CCDG 4 cut(s) 76, 196, 201, 223
MaeIII GTNAC 1 cut(s) 134
MalI GATC 2 cut(s) 42, 75
MboI GATC 2 cut(s) 40, 73
MboII GAAGA 1 cut(s) 132
MflI RGATCY 1 cut(s) 73
MluCI AATT 1 cut(s) 13
MnlI CCTC 3 cut(s) 31, 79, 88
MseI TTAA 2 cut(s) 104, 222
MslI CAYNNNNRTG 1 cut(s) 65
MspR9I CCNGG 1 cut(s) 211
MvaI CCWGG 1 cut(s) 211
NdeII GATC 2 cut(s) 40, 73
NlaIV GGNNCC 1 cut(s) 75
PflMI CCANNNNNTGG 1 cut(s) 69
Psp6I CCWGG 1 cut(s) 209
PspGI CCWGG 1 cut(s) 209
PspN4I GGNNCC 1 cut(s) 75
PsrI GAACNNNNNNTAC 1 cut(s) 33
PsuI RGATCY 1 cut(s) 73
RseI CAYNNNNRTG 1 cut(s) 65
SaqAI TTAA 2 cut(s) 104, 222
Sau3AI GATC 2 cut(s) 40, 73
ScrFI CCNGG 1 cut(s) 211
SetI ASST 3 cut(s) 54, 122, 228
SgeI CNNG 8 cut(s) 75, 136, 156, 187, 200, 211, 222, 223
SmiMI CAYNNNNRTG 1 cut(s) 65
Sse9I AATT 1 cut(s) 13
StyD4I CCNGG 1 cut(s) 209
TaaI ACNGT 2 cut(s) 22, 217
TasI AATT 1 cut(s) 13
Tru1I TTAA 2 cut(s) 104, 222
Tru9I TTAA 2 cut(s) 104, 222
TspDTI ATGAA 2 cut(s) 45, 183
Van91I CCANNNNNTGG 1 cut(s) 69
XapI RAATTY 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.