Rmu_co7994400.1_g000001

U3 small nucleolar RNA-associated protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7994400.1
Physical Location & Seq
Reverse (-)
1 .. 453
453 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7994400.1_g000001.1.cds

Sequence Viewer

Length: 177 bp
atgctctacacagagagagcacatttttaccacagatataagatccgcggaattcagaatttaatcgtctattcattgccggagagaaaggaattttaccctgaggttgttaatatggttgatggatcccacgacatggcatgcacggtgctcttttctccttttgatctcctccgg

Protein Analysis

59

Amino Acids

7.11

Weight (kDa)

6.81

Isoelectric Point (pI)

53.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 136
AccII CGCG 1 cut(s) 48
AciI CCGC 2 cut(s) 46, 48
AclWI GGATC 3 cut(s) 37, 120, 133
AcsI RAATTY 3 cut(s) 51, 58, 92
AfiI CCNNNNNNNGG 1 cut(s) 136
Alw21I GWGCWC 2 cut(s) 22, 153
AlwI GGATC 3 cut(s) 37, 120, 133
ApoI RAATTY 3 cut(s) 51, 58, 92
AxyI CCTNAGG 1 cut(s) 102
BamHI GGATCC 1 cut(s) 125
Bbv12I GWGCWC 2 cut(s) 22, 153
BccI CCATC 1 cut(s) 116
BmiI GGNNCC 1 cut(s) 127
BsaJI CCNNGG 1 cut(s) 46
Bsc4I CCNNNNNNNGG 1 cut(s) 136
Bse21I CCTNAGG 1 cut(s) 102
Bse3DI GCAATG 1 cut(s) 74
BseDI CCNNGG 1 cut(s) 46
BseLI CCNNNNNNNGG 1 cut(s) 136
BseMI GCAATG 1 cut(s) 74
BseMII CTCAG 1 cut(s) 93
BseRI GAGGAG 1 cut(s) 161
Bsh1236I CGCG 1 cut(s) 48
BsiHKAI GWGCWC 2 cut(s) 22, 153
BsiSI CCGG 2 cut(s) 80, 175
BslI CCNNNNNNNGG 1 cut(s) 136
Bsp1286I GDGCHC 2 cut(s) 22, 153
Bsp143I GATC 3 cut(s) 42, 125, 166
BspACI CCGC 2 cut(s) 46, 48
BspCNI CTCAG 1 cut(s) 94
BspFNI CGCG 1 cut(s) 48
BspLI GGNNCC 1 cut(s) 127
BspPI GGATC 3 cut(s) 37, 120, 133
BsrDI GCAATG 1 cut(s) 74
BssECI CCNNGG 1 cut(s) 46
BssMI GATC 3 cut(s) 42, 125, 166
Bst4CI ACNGT 1 cut(s) 148
BstC8I GCNNGC 1 cut(s) 142
BstDEI CTNAG 1 cut(s) 102
BstDSI CCRYGG 1 cut(s) 46
BstFNI CGCG 1 cut(s) 48
BstKTI GATC 3 cut(s) 45, 128, 169
BstMBI GATC 3 cut(s) 42, 125, 166
BstNSI RCATGY 1 cut(s) 144
BstUI CGCG 1 cut(s) 48
BstX2I RGATCY 2 cut(s) 42, 125
BstYI RGATCY 2 cut(s) 42, 125
Bsu36I CCTNAGG 1 cut(s) 102
BtgI CCRYGG 1 cut(s) 46
Cac8I GCNNGC 1 cut(s) 142
Cfr42I CCGCGG 1 cut(s) 49
CviAII CATG 2 cut(s) 136, 141
DdeI CTNAG 1 cut(s) 102
DpnI GATC 3 cut(s) 44, 127, 168
DpnII GATC 3 cut(s) 42, 125, 166
Eco81I CCTNAGG 1 cut(s) 102
EcoRI GAATTC 1 cut(s) 51
FaeI CATG 2 cut(s) 139, 144
FaiI YATR 4 cut(s) 39, 116, 137, 142
FatI CATG 2 cut(s) 135, 140
HapII CCGG 2 cut(s) 80, 175
Hin1II CATG 2 cut(s) 139, 144
HpaII CCGG 2 cut(s) 80, 175
Hpy188I TCNGA 1 cut(s) 57
HpyCH4III ACNGT 1 cut(s) 148
HpyCH4V TGCA 1 cut(s) 144
HpyF3I CTNAG 1 cut(s) 102
Hsp92II CATG 2 cut(s) 139, 144
KspI CCGCGG 1 cut(s) 49
Kzo9I GATC 3 cut(s) 42, 125, 166
LpnPI CCDG 2 cut(s) 93, 114
MalI GATC 3 cut(s) 44, 127, 168
MboI GATC 3 cut(s) 42, 125, 166
MflI RGATCY 2 cut(s) 42, 125
MhlI GDGCHC 2 cut(s) 22, 153
MluCI AATT 3 cut(s) 51, 58, 92
MnlI CCTC 1 cut(s) 97
MseI TTAA 2 cut(s) 62, 111
MspA1I CMGCKG 1 cut(s) 48
MspI CCGG 2 cut(s) 80, 175
MvnI CGCG 1 cut(s) 48
NdeII GATC 3 cut(s) 42, 125, 166
NlaIII CATG 2 cut(s) 139, 144
NlaIV GGNNCC 1 cut(s) 127
NspI RCATGY 1 cut(s) 144
PaeI GCATGC 1 cut(s) 144
PflMI CCANNNNNTGG 1 cut(s) 136
PspN4I GGNNCC 1 cut(s) 127
PsuI RGATCY 2 cut(s) 42, 125
SacII CCGCGG 1 cut(s) 49
SaqAI TTAA 2 cut(s) 62, 111
Sau3AI GATC 3 cut(s) 42, 125, 166
SduI GDGCHC 2 cut(s) 22, 153
SetI ASST 1 cut(s) 108
Sfr303I CCGCGG 1 cut(s) 49
SgeI CNNG 7 cut(s) 59, 92, 113, 143, 148, 153, 157
SgrBI CCGCGG 1 cut(s) 49
SphI GCATGC 1 cut(s) 144
Sse9I AATT 3 cut(s) 51, 58, 92
SsiI CCGC 2 cut(s) 46, 48
TaaI ACNGT 1 cut(s) 148
TasI AATT 3 cut(s) 51, 58, 92
Tru1I TTAA 2 cut(s) 62, 111
Tru9I TTAA 2 cut(s) 62, 111
TspDTI ATGAA 1 cut(s) 63
Van91I CCANNNNNTGG 1 cut(s) 136
XapI RAATTY 3 cut(s) 51, 58, 92
XceI RCATGY 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.