Rmu_co8014528.1_g000001

DUF21 domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8014528.1
Physical Location & Seq
Forward (+)
1 .. 503
503 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8014528.1_g000001.1.cds

Sequence Viewer

Length: 324 bp
gtcaaaaatctcttgatgattgatacagaagaaacagttactttgagaaaaatgatgataagaaaaattcctcgggtttcagaagacatgccgctatatgatattcttaatgaatttcagaagggtcacagtcatattgctgttgtctataaggatgtaaaggaaacactaaagaatggcaaagagagtgaaacactagaggcatcactgaggaaaggtgtgaatattcgtcctcatagcggcaaaaaaagagtttataattttacacttgttctaatttcagtttttcccagtttccttacttttgcacaagcgttttcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

12.33

Weight (kDa)

9.6

Isoelectric Point (pI)

41.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 258
AciI CCGC 2 cut(s) 92, 240
AcsI RAATTY 2 cut(s) 66, 113
AfiI CCNNNNNNNGG 1 cut(s) 239
Ama87I CYCGRG 1 cut(s) 72
ApoI RAATTY 2 cut(s) 66, 113
AvaI CYCGRG 1 cut(s) 72
BbsI GAAGAC 1 cut(s) 90
BfaI CTAG 1 cut(s) 197
BisI GCNGC 2 cut(s) 92, 241
BlsI GCNGC 2 cut(s) 93, 242
BmeT110I CYCGRG 1 cut(s) 72
BmrI ACTGGG 1 cut(s) 285
BmsI GCATC 1 cut(s) 212
BmuI ACTGGG 1 cut(s) 285
BpiI GAAGAC 1 cut(s) 90
BsaJI CCNNGG 1 cut(s) 71
Bsc4I CCNNNNNNNGG 1 cut(s) 239
Bse1I ACTGG 1 cut(s) 291
BseDI CCNNGG 1 cut(s) 71
BseGI GGATG 1 cut(s) 160
BseLI CCNNNNNNNGG 1 cut(s) 239
BseMII CTCAG 1 cut(s) 200
BseNI ACTGG 1 cut(s) 291
BsiHKCI CYCGRG 1 cut(s) 72
BslI CCNNNNNNNGG 1 cut(s) 239
BsoBI CYCGRG 1 cut(s) 72
BspACI CCGC 2 cut(s) 92, 240
BspCNI CTCAG 1 cut(s) 201
BsrI ACTGG 1 cut(s) 291
BssECI CCNNGG 1 cut(s) 71
Bst4CI ACNGT 2 cut(s) 37, 131
BstDEI CTNAG 1 cut(s) 209
BstF5I GGATG 1 cut(s) 160
BstNSI RCATGY 1 cut(s) 91
BstV2I GAAGAC 1 cut(s) 90
BtsCI GGATG 1 cut(s) 160
BtsIMutI CAGTG 1 cut(s) 206
CviAII CATG 1 cut(s) 88
DdeI CTNAG 1 cut(s) 209
Eco88I CYCGRG 1 cut(s) 72
FaeI CATG 1 cut(s) 91
FaiI YATR 7 cut(s) 89, 97, 99, 135, 150, 237, 258
FatI CATG 1 cut(s) 87
Fnu4HI GCNGC 2 cut(s) 92, 241
FokI GGATG 1 cut(s) 167
Fsp4HI GCNGC 2 cut(s) 92, 241
FspBI CTAG 1 cut(s) 197
GluI GCNGC 2 cut(s) 92, 241
Hin1II CATG 1 cut(s) 91
Hpy188I TCNGA 2 cut(s) 82, 120
Hpy188III TCNNGA 1 cut(s) 13
HpyAV CCTTC 1 cut(s) 115
HpyCH4III ACNGT 2 cut(s) 37, 131
HpyCH4V TGCA 1 cut(s) 308
HpyF3I CTNAG 1 cut(s) 209
Hsp92II CATG 1 cut(s) 91
LpnPI CCDG 1 cut(s) 304
LweI GCATC 1 cut(s) 212
MaeI CTAG 1 cut(s) 197
MaeIII GTNAC 2 cut(s) 37, 125
MboII GAAGA 2 cut(s) 41, 95
MluCI AATT 4 cut(s) 66, 113, 259, 276
MnlI CCTC 4 cut(s) 81, 193, 204, 243
MseI TTAA 2 cut(s) 108, 322
NlaIII CATG 1 cut(s) 91
NmuCI GTSAC 1 cut(s) 125
NspI RCATGY 1 cut(s) 91
PkrI GCNGC 2 cut(s) 93, 242
PsiI TTATAA 1 cut(s) 258
SaqAI TTAA 2 cut(s) 108, 322
SatI GCNGC 2 cut(s) 92, 241
SetI ASST 1 cut(s) 220
SfaNI GCATC 1 cut(s) 212
SgeI CNNG 7 cut(s) 25, 84, 86, 100, 209, 281, 303
Sse9I AATT 4 cut(s) 66, 113, 259, 276
SsiI CCGC 2 cut(s) 92, 240
SspI AATATT 1 cut(s) 226
SspMI CTAG 1 cut(s) 197
TaaI ACNGT 2 cut(s) 37, 131
TasI AATT 4 cut(s) 66, 113, 259, 276
TauI GCSGC 2 cut(s) 94, 243
Tru1I TTAA 2 cut(s) 108, 322
Tru9I TTAA 2 cut(s) 108, 322
TscAI CASTG 1 cut(s) 213
TseFI GTSAC 1 cut(s) 125
Tsp45I GTSAC 1 cut(s) 125
TspDTI ATGAA 1 cut(s) 126
TspRI CASTG 1 cut(s) 213
XapI RAATTY 2 cut(s) 66, 113
XceI RCATGY 1 cut(s) 91
XspI CTAG 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.