Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8031910.1

Orthogroup ID

OG0010543

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 359

Gene Structure 359 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8031910.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 276 bp

cagcgttacccggccgagatcttgtcacagagtctgctcgactttctgtcgctgacgctgtgtccgatgaccccattgaatgacgaccattttgacaagtcggagtcgtcaccgttggggaactcgtcggaggaggaggatcgggctatagccgagaagggtttttacttgcacctgtctccgagaatgagctccagtaatcccagagagccagagccccagcttttgccattgtttctggtcacttcgccgagagtttcagggtcgtcttcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Protein Analysis

91

Amino Acids

10.09

Weight (kDa)

4.66

Isoelectric Point (pI)

78.31

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010543)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g19800
malus_domestica	MD03G1229000.v1.1 MD11G1249800.v1.1
prunus_persica	Prupe.4G180100_v2.0.a1
pyrus_communis	pycom03g17680 pycom11g22080
rosa_chinensis	RchiOBHm_Chr5g0033211
rosa_laevigata	RLG00000033458
rosa_multiflora	Rmu_co8031910.1_g000001 Rmu_sc0003351.1_g000005 Rmu_sc0018119.1_g000002 Rmu_ssc0000238.1_g000025 Rmu_ssc0000299.1_g000004
rosa_roxburghii	Rroxscaffold_1G00046770
rosa_rugosa	Rorug05G0137900
rosa_samantha	Rh5AG229500 Rh5BG230500 Rh5CG258400 Rh5DG235300
rosa_wichuraiana	Rw2G000340 Rw5G020990

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	147
AcoI	YGGCCR	1 cut(s)	12
AgsI	TTSAA	1 cut(s)	79
AhdI	GACNNNNNGTC	2 cut(s)	46, 60
AluBI	AGCT	2 cut(s)	192, 223
AluI	AGCT	2 cut(s)	192, 223
Alw21I	GWGCWC	1 cut(s)	194
Alw26I	GTCTC	1 cut(s)	183
AlwI	GGATC	1 cut(s)	147
AlwNI	CAGNNNCTG	1 cut(s)	34
AoxI	GGCC	1 cut(s)	12
ArsI	GACNNNNNNTTYG	2 cut(s)	74, 106
AsuC2I	CCSGG	1 cut(s)	11
AsuHPI	GGTGA	1 cut(s)	102
BanII	GRGCYC	2 cut(s)	194, 219
BarI	GAAGNNNNNNTAC	2 cut(s)	149, 181
BbsI	GAAGAC	1 cut(s)	261
Bbv12I	GWGCWC	1 cut(s)	194
BcnI	CCSGG	1 cut(s)	11
BcoDI	GTCTC	1 cut(s)	183
BfmI	CTRYAG	1 cut(s)	147
BglII	AGATCT	1 cut(s)	18
Bme1390I	CCNGG	1 cut(s)	11
BmeRI	GACNNNNNGTC	2 cut(s)	46, 60
BmrFI	CCNGG	1 cut(s)	11
BpiI	GAAGAC	1 cut(s)	261
BpmI	CTGGAG	1 cut(s)	178
BpuMI	CCSGG	1 cut(s)	11
Bse1I	ACTGG	1 cut(s)	195
BseNI	ACTGG	1 cut(s)	195
BseRI	GAGGAG	2 cut(s)	146, 149
BseX3I	CGGCCG	1 cut(s)	12
BseYI	CCCAGC	1 cut(s)	219
Bsh1285I	CGRYCG	1 cut(s)	15
BshFI	GGCC	1 cut(s)	14
BsiEI	CGRYCG	1 cut(s)	15
BsiHKAI	GWGCWC	1 cut(s)	194
BsiSI	CCGG	1 cut(s)	11
BsmAI	GTCTC	1 cut(s)	183
BsnI	GGCC	1 cut(s)	14
Bsp1286I	GDGCHC	2 cut(s)	194, 219
Bsp143I	GATC	2 cut(s)	18, 139
BspANI	GGCC	1 cut(s)	14
BspPI	GGATC	1 cut(s)	147
BsrI	ACTGG	1 cut(s)	195
BssMI	GATC	2 cut(s)	18, 139
Bst4CI	ACNGT	1 cut(s)	114
BstKTI	GATC	2 cut(s)	21, 142
BstMAI	GTCTC	1 cut(s)	183
BstMBI	GATC	2 cut(s)	18, 139
BstMCI	CGRYCG	1 cut(s)	15
BstSCI	CCNGG	1 cut(s)	9
BstSFI	CTRYAG	1 cut(s)	147
BstV2I	GAAGAC	1 cut(s)	261
BstX2I	RGATCY	1 cut(s)	18
BstYI	RGATCY	1 cut(s)	18
BstZI	CGGCCG	1 cut(s)	12
BsuRI	GGCC	1 cut(s)	14
CaiI	CAGNNNCTG	1 cut(s)	34
CseI	GACGC	1 cut(s)	64
CviJI	RGCY	7 cut(s)	14, 146, 152, 192, 211, 217, 223
CviKI_1	RGCY	7 cut(s)	14, 146, 152, 192, 211, 217, 223
DpnI	GATC	2 cut(s)	20, 141
DpnII	GATC	2 cut(s)	18, 139
DriI	GACNNNNNGTC	2 cut(s)	46, 60
EaeI	YGGCCR	1 cut(s)	12
EagI	CGGCCG	1 cut(s)	12
Eam1105I	GACNNNNNGTC	2 cut(s)	46, 60
Ecl136II	GAGCTC	1 cut(s)	192
EclXI	CGGCCG	1 cut(s)	12
Eco24I	GRGCYC	2 cut(s)	194, 219
Eco52I	CGGCCG	1 cut(s)	12
Eco53kI	GAGCTC	1 cut(s)	192
EcoICRI	GAGCTC	1 cut(s)	192
EcoT38I	GRGCYC	2 cut(s)	194, 219
FaiI	YATR	1 cut(s)	149
FriOI	GRGCYC	2 cut(s)	194, 219
GsaI	CCCAGC	1 cut(s)	223
GsuI	CTGGAG	1 cut(s)	178
HaeIII	GGCC	1 cut(s)	14
HapII	CCGG	1 cut(s)	11
HgaI	GACGC	1 cut(s)	64
HinfI	GANTC	2 cut(s)	31, 104
HpaII	CCGG	1 cut(s)	11
HphI	GGTGA	1 cut(s)	102
Hpy188I	TCNGA	4 cut(s)	66, 103, 130, 183
Hpy188III	TCNNGA	1 cut(s)	273
Hpy99I	CGWCG	1 cut(s)	130
HpyAV	CCTTC	1 cut(s)	151
HpyCH4III	ACNGT	1 cut(s)	114
HpyCH4V	TGCA	1 cut(s)	172
Kzo9I	GATC	2 cut(s)	18, 139
LmnI	GCTCC	1 cut(s)	197
LpnPI	CCDG	8 cut(s)	24, 188, 208, 217, 224, 225, 233, 246
MaeIII	GTNAC	4 cut(s)	5, 24, 108, 241
MalI	GATC	2 cut(s)	20, 141
MboI	GATC	2 cut(s)	18, 139
MboII	GAAGA	1 cut(s)	261
MflI	RGATCY	1 cut(s)	18
MhlI	GDGCHC	2 cut(s)	194, 219
MlyI	GAGTC	2 cut(s)	40, 113
MmeI	TCCRAC	2 cut(s)	81, 108
MnlI	CCTC	3 cut(s)	124, 127, 130
MspI	CCGG	1 cut(s)	11
MspR9I	CCNGG	1 cut(s)	11
NciI	CCSGG	1 cut(s)	11
NdeII	GATC	2 cut(s)	18, 139
NmeAIII	GCCGAG	3 cut(s)	40, 178, 276
NmuCI	GTSAC	3 cut(s)	24, 108, 241
PcsI	WCGNNNNNNNCGW	1 cut(s)	62
PleI	GAGTC	2 cut(s)	39, 112
PpsI	GAGTC	2 cut(s)	39, 112
Psp124BI	GAGCTC	1 cut(s)	194
PspFI	CCCAGC	1 cut(s)	219
PstNI	CAGNNNCTG	1 cut(s)	34
PsuI	RGATCY	1 cut(s)	18
SacI	GAGCTC	1 cut(s)	194
Sau3AI	GATC	2 cut(s)	18, 139
SchI	GAGTC	2 cut(s)	40, 113
ScrFI	CCNGG	1 cut(s)	11
SduI	GDGCHC	2 cut(s)	194, 219
SetI	ASST	3 cut(s)	177, 194, 225
SfcI	CTRYAG	1 cut(s)	147
SstI	GAGCTC	1 cut(s)	194
StyD4I	CCNGG	1 cut(s)	9
TaaI	ACNGT	1 cut(s)	114
TaqI	TCGA	1 cut(s)	39
TseFI	GTSAC	3 cut(s)	24, 108, 241
Tsp45I	GTSAC	3 cut(s)	24, 108, 241

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.