Rmu_co8041726.1_g000001

Introduces a single-strand break via transesterification at a target site in duplex DNA. Releases the supercoiling and torsional tension of DNA introduced during the DNA replication and transcription by transiently cleaving and rejoining one strand of the DNA duplex. The scissile phosphodiester is attacked by the catalytic tyrosine of the enzyme, resulting in the formation of a DNA-(5'-phosphotyrosyl)-enzyme intermediate and the expulsion of a 3'-OH DNA strand

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8041726.1
Physical Location & Seq
Reverse (-)
2 .. 305
304 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8041726.1_g000001.1.cds

Sequence Viewer

Length: 304 bp
atgcctggcccagatggcaaatcattttctctttgcccttactgctacaatagtcctccatttgaaggtattgacacactctttggagccgcaaaatctggttcatctggcaagctgggaaagggggctggcatgccatgcttcctttgcccacatcccacatgtcgacattcattgatatcccaaggagtttgtgcttgccctgaatgtagtggaactcttgttctagaccccgtaagtgctcccaagtggcgactatgttgcaacatgtgcaatttccttgtgctcctcccccaaggggctc

Protein Analysis

101

Amino Acids

10.54

Weight (kDa)

8.02

Isoelectric Point (pI)

43.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 166
AciI CCGC 1 cut(s) 90
AfiI CCNNNNNNNGG 2 cut(s) 65, 298
AflIII ACRYGT 2 cut(s) 161, 267
AgsI TTSAA 1 cut(s) 65
AjnI CCWGG 1 cut(s) 4
AloI GAACNNNNNNTCC 2 cut(s) 207, 239
AluBI AGCT 1 cut(s) 115
AluI AGCT 1 cut(s) 115
Alw21I GWGCWC 2 cut(s) 244, 288
AoxI GGCC 1 cut(s) 7
ArsI GACNNNNNNTTYG 2 cut(s) 65, 97
AspS9I GGNCC 1 cut(s) 8
BanII GRGCYC 1 cut(s) 304
Bbv12I GWGCWC 2 cut(s) 244, 288
BccI CCATC 1 cut(s) 8
BcgI CGANNNNNNTGC 2 cut(s) 243, 277
BciT130I CCWGG 1 cut(s) 6
BfaI CTAG 1 cut(s) 227
BglI GCCNNNNNGGC 1 cut(s) 15
BisI GCNGC 1 cut(s) 90
BlsI GCNGC 1 cut(s) 91
Bme1390I CCNGG 1 cut(s) 6
BmgT120I GGNCC 1 cut(s) 8
BmiI GGNNCC 1 cut(s) 88
BmrFI CCNGG 1 cut(s) 6
BsaJI CCNNGG 2 cut(s) 184, 295
Bsc4I CCNNNNNNNGG 2 cut(s) 65, 298
BseBI CCWGG 1 cut(s) 6
BseDI CCNNGG 2 cut(s) 184, 295
BseGI GGATG 1 cut(s) 154
BseLI CCNNNNNNNGG 2 cut(s) 65, 298
BseRI GAGGAG 1 cut(s) 278
BseYI CCCAGC 1 cut(s) 115
BshFI GGCC 1 cut(s) 9
BsiHKAI GWGCWC 2 cut(s) 244, 288
BslI CCNNNNNNNGG 2 cut(s) 65, 298
BsnI GGCC 1 cut(s) 9
Bsp1286I GDGCHC 3 cut(s) 244, 288, 304
BspACI CCGC 1 cut(s) 90
BspANI GGCC 1 cut(s) 9
BspLI GGNNCC 1 cut(s) 88
BssECI CCNNGG 2 cut(s) 184, 295
BssT1I CCWWGG 2 cut(s) 184, 295
Bst2UI CCWGG 1 cut(s) 6
BstAPI GCANNNNNTGC 2 cut(s) 138, 270
BstC8I GCNNGC 4 cut(s) 113, 130, 134, 199
BstF5I GGATG 1 cut(s) 154
BstMWI GCNNNNNNNGC 5 cut(s) 15, 42, 138, 147, 270
BstNI CCWGG 1 cut(s) 6
BstNSI RCATGY 3 cut(s) 136, 165, 271
BstSCI CCNGG 1 cut(s) 4
BsuRI GGCC 1 cut(s) 9
BtsCI GGATG 1 cut(s) 154
Cac8I GCNNGC 4 cut(s) 113, 130, 134, 199
Cfr13I GGNCC 1 cut(s) 8
CviAII CATG 4 cut(s) 133, 138, 162, 268
CviJI RGCY 5 cut(s) 9, 89, 115, 128, 302
CviKI_1 RGCY 5 cut(s) 9, 89, 115, 128, 302
Eco130I CCWWGG 2 cut(s) 184, 295
Eco24I GRGCYC 1 cut(s) 304
Eco32I GATATC 1 cut(s) 180
EcoRII CCWGG 1 cut(s) 4
EcoRV GATATC 1 cut(s) 180
EcoT14I CCWWGG 2 cut(s) 184, 295
EcoT38I GRGCYC 1 cut(s) 304
ErhI CCWWGG 2 cut(s) 184, 295
FaeI CATG 4 cut(s) 136, 141, 165, 271
FaiI YATR 5 cut(s) 134, 139, 163, 259, 269
FatI CATG 4 cut(s) 132, 137, 161, 267
FblI GTMKAC 1 cut(s) 166
Fnu4HI GCNGC 1 cut(s) 90
FokI GGATG 1 cut(s) 141
FriOI GRGCYC 1 cut(s) 304
Fsp4HI GCNGC 1 cut(s) 90
FspBI CTAG 1 cut(s) 227
GluI GCNGC 1 cut(s) 90
GsaI CCCAGC 1 cut(s) 119
HaeIII GGCC 1 cut(s) 9
Hin1II CATG 4 cut(s) 136, 141, 165, 271
HincII GTYRAC 1 cut(s) 167
HindII GTYRAC 1 cut(s) 167
Hpy166II GTNNAC 1 cut(s) 167
Hpy188III TCNNGA 1 cut(s) 227
Hpy8I GTNNAC 1 cut(s) 167
HpyAV CCTTC 1 cut(s) 59
HpyCH4V TGCA 2 cut(s) 264, 273
HpyF10VI GCNNNNNNNGC 5 cut(s) 15, 42, 138, 147, 270
Hsp92II CATG 4 cut(s) 136, 141, 165, 271
LmnI GCTCC 3 cut(s) 86, 247, 291
LpnPI CCDG 7 cut(s) 18, 24, 84, 93, 101, 114, 216
MaeI CTAG 1 cut(s) 227
MhlI GDGCHC 3 cut(s) 244, 288, 304
MluCI AATT 1 cut(s) 274
MnlI CCTC 2 cut(s) 66, 299
MspR9I CCNGG 1 cut(s) 6
MvaI CCWGG 1 cut(s) 6
MwoI GCNNNNNNNGC 5 cut(s) 15, 42, 138, 147, 270
NlaIII CATG 4 cut(s) 136, 141, 165, 271
NlaIV GGNNCC 1 cut(s) 88
NspI RCATGY 3 cut(s) 136, 165, 271
PaeI GCATGC 1 cut(s) 136
PciI ACATGT 2 cut(s) 161, 267
PkrI GCNGC 1 cut(s) 91
PscI ACATGT 2 cut(s) 161, 267
Psp6I CCWGG 1 cut(s) 4
PspFI CCCAGC 1 cut(s) 115
PspGI CCWGG 1 cut(s) 4
PspN4I GGNNCC 1 cut(s) 88
PspPI GGNCC 1 cut(s) 8
SalI GTCGAC 1 cut(s) 165
SatI GCNGC 1 cut(s) 90
Sau96I GGNCC 1 cut(s) 8
ScrFI CCNGG 1 cut(s) 6
SduI GDGCHC 3 cut(s) 244, 288, 304
SetI ASST 2 cut(s) 70, 117
SphI GCATGC 1 cut(s) 136
Sse9I AATT 1 cut(s) 274
SsiI CCGC 1 cut(s) 90
SspMI CTAG 1 cut(s) 227
StyD4I CCNGG 1 cut(s) 4
StyI CCWWGG 2 cut(s) 184, 295
TaqI TCGA 1 cut(s) 166
TasI AATT 1 cut(s) 274
TauI GCSGC 1 cut(s) 92
TspDTI ATGAA 2 cut(s) 93, 162
XbaI TCTAGA 1 cut(s) 226
XceI RCATGY 3 cut(s) 136, 165, 271
XmiI GTMKAC 1 cut(s) 166
XspI CTAG 1 cut(s) 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.