Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8051752.1

Orthogroup ID

OG0003571

Physical Location & Seq

Genomic Coordinates Reverse (-)

56 .. 433

Gene Structure 378 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8051752.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

atgtcacttttcttgtcgtcgacgtttgatcaggcttatcatcagctcgcagaaatcgaagcggaactgaaagcagcaatggctggatcgaagaaagtgataacgagggaagagtgggagaagaagcttaatgatgtgaagatcaagaaggaggacatgaataaactggtgatgaatttccttgtgactgagggttatgtggatgcggcggagaaattccgaaaggaatctggaaccgaacgtatccttttttttgtttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0044424 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CLTH LisH

Protein Analysis

86

Amino Acids

9.97

Weight (kDa)

5.85

Isoelectric Point (pI)

33.6

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003571)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G61150 AT1G61150 AT1G61150 AT1G61150 AT1G61150 AT1G61150 AT1G61150 AT1G61150 AT1G61150
fragaria_vesca	FvH4_3g04570 FvH4_3g04570 FvH4_3g04570 FvH4_6g14210
malus_domestica	MD05G1322300.v1.1 MD10G1300300.v1.1
prunus_persica	Prupe.4G040500_v2.0.a1 Prupe.4G040500_v2.0.a1 Prupe.4G040500_v2.0.a1 Prupe.4G040500_v2.0.a1 Prupe.4G040500_v2.0.a1
pyrus_communis	pycom05g29660 pycom10g25300
rosa_chinensis	RchiOBHm_Chr5g0007491
rosa_laevigata	RLG00000031461
rosa_multiflora	Rmu_co8051752.1_g000001 Rmu_ssc0000182.1_g000006
rosa_roxburghii	Rroxscaffold_1G00068900
rosa_rugosa	Rorug04G0427200 Rorug04G0427300 Rorug04G0427400 Rorug04G0427600
rosa_samantha	Rh5AG055600 Rh5CG063000 Rh5DG052300
rosa_wichuraiana	Rw5G005450

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	20
AciI	CCGC	3 cut(s)	62, 206, 209
AclWI	GGATC	1 cut(s)	94
AcsI	RAATTY	2 cut(s)	175, 215
AluBI	AGCT	2 cut(s)	46, 127
AluI	AGCT	2 cut(s)	46, 127
AlwI	GGATC	1 cut(s)	94
ApeKI	GCWGC	1 cut(s)	74
ApoI	RAATTY	2 cut(s)	175, 215
AsuHPI	GGTGA	1 cut(s)	181
BbvI	GCAGC	1 cut(s)	86
BciVI	GTATCC	1 cut(s)	254
BclI	TGATCA	1 cut(s)	28
BfuI	GTATCC	1 cut(s)	254
BisI	GCNGC	2 cut(s)	75, 207
BlsI	GCNGC	2 cut(s)	76, 208
BmiI	GGNNCC	1 cut(s)	235
BmsI	GCATC	1 cut(s)	193
Bse1I	ACTGG	1 cut(s)	171
Bse3DI	GCAATG	1 cut(s)	84
BseGI	GGATG	1 cut(s)	208
BseMI	GCAATG	1 cut(s)	84
BseMII	CTCAG	1 cut(s)	180
BseNI	ACTGG	1 cut(s)	171
BseXI	GCAGC	1 cut(s)	86
Bsp143I	GATC	3 cut(s)	28, 86, 141
BspACI	CCGC	3 cut(s)	62, 206, 209
BspCNI	CTCAG	1 cut(s)	181
BspLI	GGNNCC	1 cut(s)	235
BspPI	GGATC	1 cut(s)	94
BsrDI	GCAATG	1 cut(s)	84
BsrI	ACTGG	1 cut(s)	171
BssMI	GATC	3 cut(s)	28, 86, 141
Bst6I	CTCTTC	1 cut(s)	105
BstC8I	GCNNGC	1 cut(s)	48
BstDEI	CTNAG	1 cut(s)	189
BstF5I	GGATG	1 cut(s)	208
BstKTI	GATC	3 cut(s)	31, 89, 144
BstMBI	GATC	3 cut(s)	28, 86, 141
BstMWI	GCNNNNNNNGC	1 cut(s)	80
BstV1I	GCAGC	1 cut(s)	86
BsuI	GTATCC	1 cut(s)	254
BtsCI	GGATG	1 cut(s)	208
Cac8I	GCNNGC	1 cut(s)	48
CviAII	CATG	1 cut(s)	157
CviJI	RGCY	4 cut(s)	35, 46, 83, 127
CviKI_1	RGCY	4 cut(s)	35, 46, 83, 127
DdeI	CTNAG	1 cut(s)	189
DpnI	GATC	3 cut(s)	30, 88, 143
DpnII	GATC	3 cut(s)	28, 86, 141
Eam1104I	CTCTTC	1 cut(s)	105
EarI	CTCTTC	1 cut(s)	105
EciI	GGCGGA	1 cut(s)	224
FaeI	CATG	1 cut(s)	160
FaiI	YATR	2 cut(s)	158, 198
FatI	CATG	1 cut(s)	156
FbaI	TGATCA	1 cut(s)	28
FblI	GTMKAC	1 cut(s)	20
Fnu4HI	GCNGC	2 cut(s)	75, 207
FokI	GGATG	1 cut(s)	215
Fsp4HI	GCNGC	2 cut(s)	75, 207
GluI	GCNGC	2 cut(s)	75, 207
Hin1II	CATG	1 cut(s)	160
HincII	GTYRAC	1 cut(s)	21
HindII	GTYRAC	1 cut(s)	21
HindIII	AAGCTT	1 cut(s)	125
HinfI	GANTC	1 cut(s)	227
HphI	GGTGA	1 cut(s)	181
Hpy166II	GTNNAC	1 cut(s)	21
Hpy188I	TCNGA	1 cut(s)	221
Hpy188III	TCNNGA	2 cut(s)	145, 231
Hpy8I	GTNNAC	1 cut(s)	21
Hpy99I	CGWCG	2 cut(s)	22, 25
HpyAV	CCTTC	1 cut(s)	142
HpyCH4IV	ACGT	2 cut(s)	23, 241
HpyF10VI	GCNNNNNNNGC	1 cut(s)	80
HpyF3I	CTNAG	1 cut(s)	189
HpySE526I	ACGT	2 cut(s)	23, 241
Hsp92II	CATG	1 cut(s)	160
Ksp22I	TGATCA	1 cut(s)	28
Kzo9I	GATC	3 cut(s)	28, 86, 141
LpnPI	CCDG	4 cut(s)	17, 69, 152, 216
Lsp1109I	GCAGC	1 cut(s)	86
LweI	GCATC	1 cut(s)	193
MaeII	ACGT	2 cut(s)	23, 241
MaeIII	GTNAC	2 cut(s)	3, 184
MalI	GATC	3 cut(s)	30, 88, 143
MboI	GATC	3 cut(s)	28, 86, 141
MboII	GAAGA	4 cut(s)	103, 122, 133, 151
MluCI	AATT	2 cut(s)	175, 215
MnlI	CCTC	3 cut(s)	99, 145, 184
MseI	TTAA	1 cut(s)	129
MwoI	GCNNNNNNNGC	1 cut(s)	80
NdeII	GATC	3 cut(s)	28, 86, 141
NlaIII	CATG	1 cut(s)	160
NlaIV	GGNNCC	1 cut(s)	235
NmuCI	GTSAC	2 cut(s)	3, 184
PcsI	WCGNNNNNNNCGW	1 cut(s)	54
PfeI	GAWTC	1 cut(s)	227
PkrI	GCNGC	2 cut(s)	76, 208
PspN4I	GGNNCC	1 cut(s)	235
SalI	GTCGAC	1 cut(s)	19
SaqAI	TTAA	1 cut(s)	129
SatI	GCNGC	2 cut(s)	75, 207
Sau3AI	GATC	3 cut(s)	28, 86, 141
SetI	ASST	4 cut(s)	26, 48, 129, 244
SfaNI	GCATC	1 cut(s)	193
SgrDI	CGTCGACG	1 cut(s)	19
Sse9I	AATT	2 cut(s)	175, 215
SsiI	CCGC	3 cut(s)	62, 206, 209
TaiI	ACGT	2 cut(s)	26, 244
TaqI	TCGA	3 cut(s)	20, 57, 89
TasI	AATT	2 cut(s)	175, 215
TauI	GCSGC	1 cut(s)	209
TfiI	GAWTC	1 cut(s)	227
Tru1I	TTAA	1 cut(s)	129
Tru9I	TTAA	1 cut(s)	129
TseFI	GTSAC	2 cut(s)	3, 184
TseI	GCWGC	1 cut(s)	74
Tsp45I	GTSAC	2 cut(s)	3, 184
TspDTI	ATGAA	2 cut(s)	173, 188
XapI	RAATTY	2 cut(s)	175, 215
XmiI	GTMKAC	1 cut(s)	20

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.