Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8105006.1

Orthogroup ID

OG0004042

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 483

Gene Structure 482 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8105006.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 482 bp

atggaggaatggtttcgaagaaatggtgcagagtactcatacatggctactgagcttgacaataaagcttcactaaatcttttcacccaaaaatgctactacaccaaatttcgcaccccttcaattttggtccaaccagtctttgctcaccgagtcaaaactcaccgcaaccgagtcaccattattgaactcactccaccagaggctgagaccctctaccgccgccaattctctgccaccgagttttttcctcaggacattgatagaattgtggaaaacaagctcaatgtaggtacatttttagctgtcccaaccgagtttttgtggacgggtttggaaaggtttctatccaagccgcccgagtcatgggctgttttgagtgcatggaattgtaaggaggtgtttacattggaaatcaaaggtgcatcgcttgcacggcgcttggctgccaaggcaactcgcatggtggatagggcgctgcc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Acetyltransf_1

Protein Analysis

161

Amino Acids

18.75

Weight (kDa)

9.36

Isoelectric Point (pI)

44.86

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004042)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G23060 AT2G23060 AT4G37580 AT4G37580 AT5G67430 AT5G67430
fragaria_vesca	FvH4_1g17420 FvH4_2g04100
malus_domestica	MD02G1183200.v1.1 MD15G1295100.v1.1
prunus_persica	Prupe.6G222600_v2.0.a1 Prupe.8G142200_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0107611 RchiOBHm_Chr6g0253471
rosa_laevigata	RLG00000015017 RLG00000017595
rosa_multiflora	Rmu_co8105006.1_g000001 Rmu_sc0000800.1_g000038 Rmu_sc0042258.1_g000001 Rmu_ssc0000079.1_g000009
rosa_roxburghii	Rroxscaffold_2G00136150 Rroxscaffold_7G00211870
rosa_rugosa	Rorug02G0146000 Rorug05G0544500
rosa_samantha	Rh2AG195300 Rh2BG207900 Rh2CG200500 Rh2DG203000 Rh6AG059500 Rh6BG053500 Rh6CG050600 Rh6DG047300
rosa_wichuraiana	Rw2G015480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	4 cut(s)	166, 220, 223, 356
AcsI	RAATTY	1 cut(s)	107
AfaI	GTAC	2 cut(s)	35, 295
AfiI	CCNNNNNNNGG	1 cut(s)	366
AgsI	TTSAA	2 cut(s)	123, 188
AluBI	AGCT	4 cut(s)	55, 68, 283, 305
AluI	AGCT	4 cut(s)	55, 68, 283, 305
Alw26I	GTCTC	1 cut(s)	203
AlwNI	CAGNNNCTG	1 cut(s)	206
Ama87I	CYCGRG	1 cut(s)	359
ApeKI	GCWGC	2 cut(s)	446, 478
ApoI	RAATTY	1 cut(s)	107
Asp700I	GAANNNNTTC	2 cut(s)	12, 342
AspLEI	GCGC	2 cut(s)	441, 478
AspS9I	GGNCC	1 cut(s)	130
AsuHPI	GGTGA	4 cut(s)	76, 140, 155, 169
AsuII	TTCGAA	1 cut(s)	16
AvaI	CYCGRG	1 cut(s)	359
AvaII	GGWCC	1 cut(s)	130
AxyI	CCTNAGG	1 cut(s)	252
BbvI	GCAGC	2 cut(s)	433, 465
BceAI	ACGGC	1 cut(s)	452
BcoDI	GTCTC	1 cut(s)	203
BfoI	RGCGCY	2 cut(s)	442, 479
BisI	GCNGC	4 cut(s)	223, 356, 447, 479
BlsI	GCNGC	4 cut(s)	224, 357, 448, 480
BmcAI	AGTACT	1 cut(s)	35
Bme18I	GGWCC	1 cut(s)	130
BmeT110I	CYCGRG	1 cut(s)	359
BmgT120I	GGNCC	1 cut(s)	130
BmsI	GCATC	1 cut(s)	434
Bpu14I	TTCGAA	1 cut(s)	16
BsaI	GGTCTC	1 cut(s)	203
BsaJI	CCNNGG	1 cut(s)	450
BsaXI	ACNNNNNCTCC	1 cut(s)	26
Bsc4I	CCNNNNNNNGG	1 cut(s)	366
Bse1I	ACTGG	1 cut(s)	137
Bse21I	CCTNAGG	1 cut(s)	252
BseDI	CCNNGG	1 cut(s)	450
BseLI	CCNNNNNNNGG	1 cut(s)	366
BseMII	CTCAG	3 cut(s)	42, 198, 266
BseNI	ACTGG	1 cut(s)	137
BseXI	GCAGC	2 cut(s)	433, 465
BsgI	GTGCAG	1 cut(s)	48
BsiHKCI	CYCGRG	1 cut(s)	359
BslFI	GGGAC	1 cut(s)	293
BslI	CCNNNNNNNGG	1 cut(s)	366
BsmAI	GTCTC	1 cut(s)	203
BsmFI	GGGAC	1 cut(s)	293
Bso31I	GGTCTC	1 cut(s)	203
BsoBI	CYCGRG	1 cut(s)	359
Bsp119I	TTCGAA	1 cut(s)	16
BspACI	CCGC	4 cut(s)	166, 220, 223, 356
BspCNI	CTCAG	3 cut(s)	43, 199, 265
BspT104I	TTCGAA	1 cut(s)	16
BspTNI	GGTCTC	1 cut(s)	203
BsrI	ACTGG	1 cut(s)	137
BssECI	CCNNGG	1 cut(s)	450
BssT1I	CCWWGG	1 cut(s)	450
BstAPI	GCANNNNNTGC	1 cut(s)	431
BstBI	TTCGAA	1 cut(s)	16
BstC8I	GCNNGC	1 cut(s)	432
BstDEI	CTNAG	3 cut(s)	51, 207, 252
BstH2I	RGCGCY	2 cut(s)	442, 479
BstHHI	GCGC	2 cut(s)	441, 478
BstMAI	GTCTC	1 cut(s)	203
BstMWI	GCNNNNNNNGC	3 cut(s)	431, 436, 452
BstV1I	GCAGC	2 cut(s)	433, 465
Bsu36I	CCTNAGG	1 cut(s)	252
BtgZI	GCGATG	1 cut(s)	411
Cac8I	GCNNGC	1 cut(s)	432
CaiI	CAGNNNCTG	1 cut(s)	206
CfoI	GCGC	2 cut(s)	441, 478
Cfr13I	GGNCC	1 cut(s)	130
Csp6I	GTAC	2 cut(s)	34, 294
CviAII	CATG	4 cut(s)	43, 366, 384, 463
CviJI	RGCY	9 cut(s)	47, 55, 68, 206, 283, 305, 355, 371, 446
CviKI_1	RGCY	9 cut(s)	47, 55, 68, 206, 283, 305, 355, 371, 446
CviQI	GTAC	2 cut(s)	34, 294
DdeI	CTNAG	3 cut(s)	51, 207, 252
Eco130I	CCWWGG	1 cut(s)	450
Eco31I	GGTCTC	1 cut(s)	203
Eco47I	GGWCC	1 cut(s)	130
Eco81I	CCTNAGG	1 cut(s)	252
Eco88I	CYCGRG	1 cut(s)	359
EcoT14I	CCWWGG	1 cut(s)	450
ErhI	CCWWGG	1 cut(s)	450
FaeI	CATG	4 cut(s)	46, 369, 387, 466
FaiI	YATR	5 cut(s)	40, 44, 367, 385, 464
FaqI	GGGAC	1 cut(s)	293
FatI	CATG	4 cut(s)	42, 365, 383, 462
Fnu4HI	GCNGC	4 cut(s)	223, 356, 447, 479
Fsp4HI	GCNGC	4 cut(s)	223, 356, 447, 479
GlaI	GCGC	2 cut(s)	440, 477
GluI	GCNGC	4 cut(s)	223, 356, 447, 479
HaeII	RGCGCY	2 cut(s)	442, 479
HhaI	GCGC	2 cut(s)	441, 478
Hin1II	CATG	4 cut(s)	46, 369, 387, 466
Hin6I	GCGC	2 cut(s)	439, 476
HinP1I	GCGC	2 cut(s)	439, 476
HindIII	AAGCTT	1 cut(s)	66
HinfI	GANTC	3 cut(s)	153, 174, 362
HphI	GGTGA	4 cut(s)	76, 140, 155, 169
Hpy166II	GTNNAC	2 cut(s)	327, 405
Hpy188III	TCNNGA	1 cut(s)	254
Hpy8I	GTNNAC	2 cut(s)	327, 405
HpyAV	CCTTC	1 cut(s)	129
HpyCH4V	TGCA	4 cut(s)	29, 383, 425, 434
HpyF10VI	GCNNNNNNNGC	3 cut(s)	431, 436, 452
HpyF3I	CTNAG	3 cut(s)	51, 207, 252
Hsp92II	CATG	4 cut(s)	46, 369, 387, 466
HspAI	GCGC	2 cut(s)	439, 476
LpnPI	CCDG	3 cut(s)	150, 213, 239
Lsp1109I	GCAGC	2 cut(s)	433, 465
LweI	GCATC	1 cut(s)	434
MaeIII	GTNAC	1 cut(s)	175
MboII	GAAGA	1 cut(s)	30
MluCI	AATT	5 cut(s)	107, 123, 227, 267, 388
MlyI	GAGTC	3 cut(s)	162, 183, 371
MmeI	TCCRAC	1 cut(s)	157
MnlI	CCTC	4 cut(s)	196, 224, 261, 391
MroXI	GAANNNNTTC	2 cut(s)	12, 342
MwoI	GCNNNNNNNGC	3 cut(s)	431, 436, 452
NlaIII	CATG	4 cut(s)	46, 369, 387, 466
NmuCI	GTSAC	1 cut(s)	175
NspV	TTCGAA	1 cut(s)	16
PdmI	GAANNNNTTC	2 cut(s)	12, 342
PkrI	GCNGC	4 cut(s)	224, 357, 448, 480
PleI	GAGTC	3 cut(s)	161, 182, 370
PpsI	GAGTC	3 cut(s)	161, 182, 370
PspPI	GGNCC	1 cut(s)	130
PstNI	CAGNNNCTG	1 cut(s)	206
RsaI	GTAC	2 cut(s)	35, 295
RsaNI	GTAC	2 cut(s)	34, 294
SatI	GCNGC	4 cut(s)	223, 356, 447, 479
Sau96I	GGNCC	1 cut(s)	130
ScaI	AGTACT	1 cut(s)	35
SchI	GAGTC	3 cut(s)	162, 183, 371
SetI	ASST	8 cut(s)	57, 70, 285, 295, 307, 344, 402, 424
SfaNI	GCATC	1 cut(s)	434
SfuI	TTCGAA	1 cut(s)	16
SinI	GGWCC	1 cut(s)	130
Sse9I	AATT	5 cut(s)	107, 123, 227, 267, 388
SsiI	CCGC	4 cut(s)	166, 220, 223, 356
StyI	CCWWGG	1 cut(s)	450
TaqI	TCGA	1 cut(s)	16
TasI	AATT	5 cut(s)	107, 123, 227, 267, 388
TatI	WGTACW	1 cut(s)	33
TauI	GCSGC	2 cut(s)	225, 358
TseFI	GTSAC	1 cut(s)	175
TseI	GCWGC	2 cut(s)	446, 478
Tsp45I	GTSAC	1 cut(s)	175
VpaK11BI	GGWCC	1 cut(s)	130
XapI	RAATTY	1 cut(s)	107
XmnI	GAANNNNTTC	2 cut(s)	12, 342
ZrmI	AGTACT	1 cut(s)	35

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.