Rmu_co8135076.1_g000001

DnaJ homolog subfamily B member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8135076.1
Physical Location & Seq
Reverse (-)
2 .. 634
633 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8135076.1_g000001.1.cds

Sequence Viewer

Length: 323 bp
tctatgaggatggtgaacccataattgatggagaacctggagatttaaaatttcgtatccgcacggcacctcatgaccagttcagaagggaaggcaatgacttgcatacaaccatcactatcacactggttcaagctctggttggctttgagaagaccattaaacaccttgatgatcatttggtggacatcagctcaaagaaaattacaaagcccaaggaagtcagaaaattcaaaggggaagggatgcctttgcacttccactcaaagaaaggagacttatacgtcacatttgaggttctattccccacttcactaacagaa

Protein Analysis

107

Amino Acids

12.26

Weight (kDa)

6.32

Isoelectric Point (pI)

18.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 283
AccB1I GGYRCC 1 cut(s) 66
AciI CCGC 1 cut(s) 60
AcsI RAATTY 2 cut(s) 49, 229
AgsI TTSAA 2 cut(s) 133, 234
AjnI CCWGG 1 cut(s) 36
AluBI AGCT 2 cut(s) 136, 194
AluI AGCT 2 cut(s) 136, 194
Alw26I GTCTC 1 cut(s) 269
ApoI RAATTY 2 cut(s) 49, 229
AsuHPI GGTGA 1 cut(s) 25
BanI GGYRCC 1 cut(s) 66
BbsI GAAGAC 1 cut(s) 160
BccI CCATC 3 cut(s) 4, 22, 121
BceAI ACGGC 1 cut(s) 80
BciT130I CCWGG 1 cut(s) 38
BciVI GTATCC 1 cut(s) 67
BclI TGATCA 1 cut(s) 174
BcoDI GTCTC 1 cut(s) 269
BfuI GTATCC 1 cut(s) 67
Bme1390I CCNGG 1 cut(s) 38
BmiI GGNNCC 1 cut(s) 68
BmrFI CCNGG 1 cut(s) 38
BmsI GCATC 1 cut(s) 236
BpiI GAAGAC 1 cut(s) 160
BpmI CTGGAG 1 cut(s) 59
BsaJI CCNNGG 1 cut(s) 215
Bse1I ACTGG 2 cut(s) 78, 131
Bse3DI GCAATG 1 cut(s) 102
BseBI CCWGG 1 cut(s) 38
BseDI CCNNGG 1 cut(s) 215
BseGI GGATG 2 cut(s) 15, 251
BseMI GCAATG 1 cut(s) 102
BseNI ACTGG 2 cut(s) 78, 131
BshNI GGYRCC 1 cut(s) 66
BsmAI GTCTC 1 cut(s) 269
Bsp143I GATC 1 cut(s) 174
BspACI CCGC 1 cut(s) 60
BspHI TCATGA 1 cut(s) 72
BspLI GGNNCC 1 cut(s) 68
BspT107I GGYRCC 1 cut(s) 66
BsrDI GCAATG 1 cut(s) 102
BsrI ACTGG 2 cut(s) 78, 131
BssECI CCNNGG 1 cut(s) 215
BssMI GATC 1 cut(s) 174
BssT1I CCWWGG 1 cut(s) 215
Bst2UI CCWGG 1 cut(s) 38
BstF5I GGATG 2 cut(s) 15, 251
BstKTI GATC 1 cut(s) 177
BstMAI GTCTC 1 cut(s) 269
BstMBI GATC 1 cut(s) 174
BstNI CCWGG 1 cut(s) 38
BstSCI CCNGG 1 cut(s) 36
BstV2I GAAGAC 1 cut(s) 160
BsuI GTATCC 1 cut(s) 67
BtsCI GGATG 2 cut(s) 15, 251
BtsIMutI CAGTG 1 cut(s) 124
CciI TCATGA 1 cut(s) 72
CviAII CATG 1 cut(s) 73
CviJI RGCY 4 cut(s) 136, 146, 194, 213
CviKI_1 RGCY 4 cut(s) 136, 146, 194, 213
DpnI GATC 1 cut(s) 176
DpnII GATC 1 cut(s) 174
DraI TTTAAA 1 cut(s) 47
DrdI GACNNNNNNGTC 1 cut(s) 283
DseDI GACNNNNNNGTC 1 cut(s) 283
Eco130I CCWWGG 1 cut(s) 215
EcoRII CCWGG 1 cut(s) 36
EcoT14I CCWWGG 1 cut(s) 215
ErhI CCWWGG 1 cut(s) 215
FaeI CATG 1 cut(s) 76
FaiI YATR 5 cut(s) 5, 22, 74, 107, 282
FatI CATG 1 cut(s) 72
FbaI TGATCA 1 cut(s) 174
FokI GGATG 2 cut(s) 22, 258
GsuI CTGGAG 1 cut(s) 59
Hin1II CATG 1 cut(s) 76
HphI GGTGA 1 cut(s) 25
Hpy166II GTNNAC 2 cut(s) 16, 186
Hpy188I TCNGA 2 cut(s) 85, 226
Hpy188III TCNNGA 1 cut(s) 73
Hpy8I GTNNAC 2 cut(s) 16, 186
HpyAV CCTTC 3 cut(s) 80, 85, 235
HpyCH4IV ACGT 1 cut(s) 284
HpyCH4V TGCA 2 cut(s) 105, 255
HpySE526I ACGT 1 cut(s) 284
Hsp92II CATG 1 cut(s) 76
Ksp22I TGATCA 1 cut(s) 174
Kzo9I GATC 1 cut(s) 174
LpnPI CCDG 5 cut(s) 23, 50, 91, 112, 124
LweI GCATC 1 cut(s) 236
MaeII ACGT 1 cut(s) 284
MaeIII GTNAC 1 cut(s) 285
MalI GATC 1 cut(s) 176
MboI GATC 1 cut(s) 174
MboII GAAGA 1 cut(s) 165
MluCI AATT 4 cut(s) 23, 49, 203, 229
MnlI CCTC 2 cut(s) 80, 288
MseI TTAA 2 cut(s) 46, 161
MslI CAYNNNNRTG 1 cut(s) 170
MspR9I CCNGG 1 cut(s) 38
MvaI CCWGG 1 cut(s) 38
NdeII GATC 1 cut(s) 174
NlaIII CATG 1 cut(s) 76
NlaIV GGNNCC 1 cut(s) 68
NmuCI GTSAC 1 cut(s) 285
PagI TCATGA 1 cut(s) 72
Psp6I CCWGG 1 cut(s) 36
PspGI CCWGG 1 cut(s) 36
PspN4I GGNNCC 1 cut(s) 68
RseI CAYNNNNRTG 1 cut(s) 170
SaqAI TTAA 2 cut(s) 46, 161
Sau3AI GATC 1 cut(s) 174
ScrFI CCNGG 1 cut(s) 38
SetI ASST 7 cut(s) 39, 72, 138, 170, 196, 287, 299
SfaNI GCATC 1 cut(s) 236
SmiMI CAYNNNNRTG 1 cut(s) 170
Sse9I AATT 4 cut(s) 23, 49, 203, 229
SsiI CCGC 1 cut(s) 60
StyD4I CCNGG 1 cut(s) 36
StyI CCWWGG 1 cut(s) 215
TaiI ACGT 1 cut(s) 287
TasI AATT 4 cut(s) 23, 49, 203, 229
Tru1I TTAA 2 cut(s) 46, 161
Tru9I TTAA 2 cut(s) 46, 161
TscAI CASTG 1 cut(s) 131
TseFI GTSAC 1 cut(s) 285
Tsp45I GTSAC 1 cut(s) 285
TspRI CASTG 1 cut(s) 131
XapI RAATTY 2 cut(s) 49, 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.