Rmu_co8179602.1_g000001
MYB Family

SANT SWI3, ADA2, N-CoR and TFIIIB'' DNA-binding domains

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8179602.1
Physical Location & Seq
Forward (+)
1 .. 562
562 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8179602.1_g000001.1.cds

Sequence Viewer

Length: 246 bp
gacaaatggagaaatcttctgagaagtagctgtcgaaggaaactgaagaaagaggttgaggaaaacgaggagaatgacatgcatttaccaaagtcactaatataccgtgtccgtgagctggcaaagaaacatccatatccaaggcagcgtggtaaaaagtgttcccctgccatactccctgctgaaagcaaaggtgcttcgactgaccttatcattaagtatgtgagaaggaagaaccgttcttaa

Protein Analysis

81

Amino Acids

9.65

Weight (kDa)

10.29

Isoelectric Point (pI)

72.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 65
AfiI CCNNNNNNNGG 1 cut(s) 118
AloI GAACNNNNNNTCC 1 cut(s) 223
AluBI AGCT 2 cut(s) 30, 118
AluI AGCT 2 cut(s) 30, 118
ApeKI GCWGC 1 cut(s) 145
BbvI GCAGC 1 cut(s) 157
BisI GCNGC 1 cut(s) 146
BlsI GCNGC 1 cut(s) 147
BsaJI CCNNGG 1 cut(s) 140
Bsc4I CCNNNNNNNGG 1 cut(s) 118
BseDI CCNNGG 1 cut(s) 140
BseGI GGATG 1 cut(s) 130
BseLI CCNNNNNNNGG 1 cut(s) 118
BseMII CTCAG 1 cut(s) 11
BseRI GAGGAG 1 cut(s) 83
BseXI GCAGC 1 cut(s) 157
BslI CCNNNNNNNGG 1 cut(s) 118
BspCNI CTCAG 1 cut(s) 12
BssECI CCNNGG 1 cut(s) 140
BssT1I CCWWGG 1 cut(s) 140
Bst4CI ACNGT 2 cut(s) 107, 239
BstC8I GCNNGC 1 cut(s) 120
BstDEI CTNAG 1 cut(s) 20
BstF5I GGATG 1 cut(s) 130
BstNSI RCATGY 1 cut(s) 82
BstV1I GCAGC 1 cut(s) 157
BtsCI GGATG 1 cut(s) 130
Cac8I GCNNGC 1 cut(s) 120
CviAII CATG 1 cut(s) 79
CviJI RGCY 2 cut(s) 30, 118
CviKI_1 RGCY 2 cut(s) 30, 118
DdeI CTNAG 1 cut(s) 20
Eco130I CCWWGG 1 cut(s) 140
Eco57I CTGAAG 1 cut(s) 65
EcoT14I CCWWGG 1 cut(s) 140
EcoT22I ATGCAT 1 cut(s) 84
ErhI CCWWGG 1 cut(s) 140
FaeI CATG 1 cut(s) 82
FaiI YATR 5 cut(s) 80, 103, 136, 173, 222
FatI CATG 1 cut(s) 78
Fnu4HI GCNGC 1 cut(s) 146
FokI GGATG 1 cut(s) 117
Fsp4HI GCNGC 1 cut(s) 146
GluI GCNGC 1 cut(s) 146
Hin1II CATG 1 cut(s) 82
Hpy188I TCNGA 1 cut(s) 21
HpyAV CCTTC 2 cut(s) 30, 222
HpyCH4III ACNGT 2 cut(s) 107, 239
HpyCH4V TGCA 1 cut(s) 82
HpyF3I CTNAG 1 cut(s) 20
Hsp92II CATG 1 cut(s) 82
LpnPI CCDG 3 cut(s) 104, 180, 192
Lsp1109I GCAGC 1 cut(s) 157
MaeIII GTNAC 1 cut(s) 93
MboII GAAGA 3 cut(s) 8, 58, 244
MnlI CCTC 3 cut(s) 46, 52, 61
Mph1103I ATGCAT 1 cut(s) 84
MseI TTAA 2 cut(s) 216, 244
NlaIII CATG 1 cut(s) 82
NmuCI GTSAC 1 cut(s) 93
NsiI ATGCAT 1 cut(s) 84
NspI RCATGY 1 cut(s) 82
PkrI GCNGC 1 cut(s) 147
PsrI GAACNNNNNNTAC 2 cut(s) 145, 177
SaqAI TTAA 2 cut(s) 216, 244
SatI GCNGC 1 cut(s) 146
SetI ASST 5 cut(s) 32, 57, 120, 196, 210
SgeI CNNG 9 cut(s) 79, 91, 119, 125, 131, 153, 161, 179, 191
StyI CCWWGG 1 cut(s) 140
TaaI ACNGT 2 cut(s) 107, 239
TaqI TCGA 2 cut(s) 34, 200
Tru1I TTAA 2 cut(s) 216, 244
Tru9I TTAA 2 cut(s) 216, 244
TseFI GTSAC 1 cut(s) 93
TseI GCWGC 1 cut(s) 145
Tsp45I GTSAC 1 cut(s) 93
TspGWI ACGGA 1 cut(s) 101
XceI RCATGY 1 cut(s) 82
Zsp2I ATGCAT 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.