Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8195346.1

Orthogroup ID

OG0006533

Physical Location & Seq

Genomic Coordinates Forward (+)

6 .. 443

Gene Structure 438 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8195346.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 438 bp

atgcccaatactgaaaaggaaggtcatagtcctagccctagtaattatttttcaaatccaagcagtcctgtatttggttccagtgttgcacacatcaggcaatttcctatgtccccaaatccagttaaggcaccaactactagtgcaagtgcaagttcaagttccctcctgggcagaagaagcatgtacactcaagggttcaatccttacggtcatagggttgccccagcagttcatatcagatcggtgattcctgtttgtgcagcaccatctgtagcagtgaggcccttagtagtaactccatcatacccaccaccattgccaatattaccaagaatgaaagaaacttgtagcaccagttccggtcctggtactagtgctagtactagttcacaaccagcagcagtagcagtcctgaaagagagtgattctacatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003725 GO:0005488 GO:0097159 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

dsrm

Protein Analysis

145

Amino Acids

15.06

Weight (kDa)

9.83

Isoelectric Point (pI)

83.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006533)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G26932 AT3G26932 AT3G26932 AT5G41070
fragaria_vesca	FvH4_6g04510 FvH4_6g53980
malus_domestica	MD09G1006600.v1.1 MD17G1010500.v1.1
prunus_persica	Prupe.3G310400_v2.0.a1 Prupe.3G310400_v2.0.a1 Prupe.3G310400_v2.0.a1 Prupe.3G310400_v2.0.a1
pyrus_communis	pycom111g00490 pycom17g00530
rosa_chinensis	RchiOBHm_Chr2g0176151
rosa_laevigata	RLG00000022385
rosa_multiflora	Rmu_co8195346.1_g000001
rosa_roxburghii	Rroxscaffold_2G00076730
rosa_rugosa	Rorug02G0591000 Rorug02G0591000 Rorug02G0591100
rosa_samantha	Rh2AG669700 Rh2BG681300 Rh2CG644200 Rh2DG695000
rosa_wichuraiana	Rw2G054940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	130
AfaI	GTAC	3 cut(s)	188, 373, 385
AfiI	CCNNNNNNNGG	1 cut(s)	74
AgsI	TTSAA	3 cut(s)	54, 159, 202
AhlI	ACTAGT	3 cut(s)	140, 374, 386
AjnI	CCWGG	2 cut(s)	168, 367
AoxI	GGCC	1 cut(s)	284
ApeKI	GCWGC	2 cut(s)	263, 401
AspS9I	GGNCC	2 cut(s)	285, 365
AsuHPI	GGTGA	1 cut(s)	259
AvaII	GGWCC	1 cut(s)	365
BanI	GGYRCC	1 cut(s)	130
BbvI	GCAGC	2 cut(s)	275, 413
BccI	CCATC	2 cut(s)	277, 310
BciT130I	CCWGG	2 cut(s)	170, 369
BcuI	ACTAGT	3 cut(s)	140, 374, 386
BfaI	CTAG	6 cut(s)	33, 39, 141, 375, 381, 387
BfmI	CTRYAG	1 cut(s)	273
BisI	GCNGC	2 cut(s)	264, 402
BlsI	GCNGC	2 cut(s)	265, 403
BmcAI	AGTACT	1 cut(s)	385
Bme1390I	CCNGG	2 cut(s)	170, 369
Bme18I	GGWCC	1 cut(s)	365
BmgT120I	GGNCC	2 cut(s)	285, 365
BmiI	GGNNCC	2 cut(s)	79, 132
BmrFI	CCNGG	2 cut(s)	170, 369
BpuEI	CTTGAG	1 cut(s)	177
BsaJI	CCNNGG	1 cut(s)	169
BsaWI	WCCGGW	1 cut(s)	362
Bsc4I	CCNNNNNNNGG	1 cut(s)	74
Bse1I	ACTGG	3 cut(s)	81, 122, 357
Bse3DI	GCAATG	1 cut(s)	317
BseBI	CCWGG	2 cut(s)	170, 369
BseDI	CCNNGG	1 cut(s)	169
BseLI	CCNNNNNNNGG	1 cut(s)	74
BseMI	GCAATG	1 cut(s)	317
BseNI	ACTGG	3 cut(s)	81, 122, 357
BseXI	GCAGC	2 cut(s)	275, 413
BseYI	CCCAGC	1 cut(s)	226
BsgI	GTGCAG	1 cut(s)	282
BshFI	GGCC	1 cut(s)	286
BshNI	GGYRCC	1 cut(s)	130
BsiSI	CCGG	1 cut(s)	363
BslFI	GGGAC	1 cut(s)	97
BslI	CCNNNNNNNGG	1 cut(s)	74
BsmFI	GGGAC	1 cut(s)	97
BsnI	GGCC	1 cut(s)	286
Bsp1407I	TGTACA	1 cut(s)	186
Bsp143I	GATC	1 cut(s)	242
BspANI	GGCC	1 cut(s)	286
BspLI	GGNNCC	2 cut(s)	79, 132
BspT107I	GGYRCC	1 cut(s)	130
BsrDI	GCAATG	1 cut(s)	317
BsrGI	TGTACA	1 cut(s)	186
BsrI	ACTGG	3 cut(s)	81, 122, 357
BssECI	CCNNGG	1 cut(s)	169
BssMI	GATC	1 cut(s)	242
Bst2UI	CCWGG	2 cut(s)	170, 369
Bst4CI	ACNGT	1 cut(s)	212
BstAUI	TGTACA	1 cut(s)	186
BstDEI	CTNAG	1 cut(s)	289
BstKTI	GATC	1 cut(s)	245
BstMBI	GATC	1 cut(s)	242
BstMWI	GCNNNNNNNGC	2 cut(s)	180, 407
BstNI	CCWGG	2 cut(s)	170, 369
BstNSI	RCATGY	1 cut(s)	187
BstSCI	CCNGG	2 cut(s)	168, 367
BstSFI	CTRYAG	1 cut(s)	273
BstV1I	GCAGC	2 cut(s)	275, 413
BsuRI	GGCC	1 cut(s)	286
BtsI	GCAGTG	1 cut(s)	285
BtsIMutI	CAGTG	2 cut(s)	88, 285
Cfr13I	GGNCC	2 cut(s)	285, 365
Csp6I	GTAC	3 cut(s)	187, 372, 384
CspCI	CAANNNNNGTGG	2 cut(s)	300, 335
CviAII	CATG	2 cut(s)	184, 435
CviJI	RGCY	2 cut(s)	36, 286
CviKI_1	RGCY	2 cut(s)	36, 286
CviQI	GTAC	3 cut(s)	187, 372, 384
DdeI	CTNAG	1 cut(s)	289
DpnI	GATC	1 cut(s)	244
DpnII	GATC	1 cut(s)	242
Eco47I	GGWCC	1 cut(s)	365
EcoO109I	RGGNCCY	1 cut(s)	285
EcoRII	CCWGG	2 cut(s)	168, 367
FaeI	CATG	2 cut(s)	187, 438
FaiI	YATR	7 cut(s)	27, 110, 185, 216, 237, 307, 436
FaqI	GGGAC	1 cut(s)	97
FatI	CATG	2 cut(s)	183, 434
Fnu4HI	GCNGC	2 cut(s)	264, 402
Fsp4HI	GCNGC	2 cut(s)	264, 402
FspBI	CTAG	6 cut(s)	33, 39, 141, 375, 381, 387
GluI	GCNGC	2 cut(s)	264, 402
GsaI	CCCAGC	1 cut(s)	230
HaeIII	GGCC	1 cut(s)	286
HapII	CCGG	1 cut(s)	363
Hin1II	CATG	2 cut(s)	187, 438
HinfI	GANTC	2 cut(s)	250, 428
HpaII	CCGG	1 cut(s)	363
HphI	GGTGA	1 cut(s)	259
Hpy166II	GTNNAC	2 cut(s)	189, 392
Hpy188I	TCNGA	1 cut(s)	242
Hpy188III	TCNNGA	1 cut(s)	415
Hpy8I	GTNNAC	2 cut(s)	189, 392
HpyAV	CCTTC	1 cut(s)	14
HpyCH4III	ACNGT	1 cut(s)	212
HpyCH4V	TGCA	4 cut(s)	89, 146, 152, 263
HpyF10VI	GCNNNNNNNGC	2 cut(s)	180, 407
HpyF3I	CTNAG	1 cut(s)	289
Hsp92II	CATG	2 cut(s)	187, 438
Kzo9I	GATC	1 cut(s)	242
Lsp1109I	GCAGC	2 cut(s)	275, 413
MaeI	CTAG	6 cut(s)	33, 39, 141, 375, 381, 387
MaeIII	GTNAC	1 cut(s)	295
MalI	GATC	1 cut(s)	244
MboI	GATC	1 cut(s)	242
MboII	GAAGA	1 cut(s)	189
MluCI	AATT	2 cut(s)	43, 101
MnlI	CCTC	2 cut(s)	176, 276
MseI	TTAA	1 cut(s)	126
MspI	CCGG	1 cut(s)	363
MspR9I	CCNGG	2 cut(s)	170, 369
MvaI	CCWGG	2 cut(s)	170, 369
MwoI	GCNNNNNNNGC	2 cut(s)	180, 407
NdeII	GATC	1 cut(s)	242
NlaIII	CATG	2 cut(s)	187, 438
NlaIV	GGNNCC	2 cut(s)	79, 132
NspI	RCATGY	1 cut(s)	187
PfeI	GAWTC	2 cut(s)	250, 428
PkrI	GCNGC	2 cut(s)	265, 403
Psp6I	CCWGG	2 cut(s)	168, 367
PspFI	CCCAGC	1 cut(s)	226
PspGI	CCWGG	2 cut(s)	168, 367
PspN4I	GGNNCC	2 cut(s)	79, 132
PspPI	GGNCC	2 cut(s)	285, 365
PsrI	GAACNNNNNNTAC	2 cut(s)	343, 375
RsaI	GTAC	3 cut(s)	188, 373, 385
RsaNI	GTAC	3 cut(s)	187, 372, 384
SaqAI	TTAA	1 cut(s)	126
SatI	GCNGC	2 cut(s)	264, 402
Sau3AI	GATC	1 cut(s)	242
Sau96I	GGNCC	2 cut(s)	285, 365
ScaI	AGTACT	1 cut(s)	385
ScrFI	CCNGG	2 cut(s)	170, 369
SetI	ASST	1 cut(s)	25
SfcI	CTRYAG	1 cut(s)	273
SinI	GGWCC	1 cut(s)	365
SmlI	CTYRAG	1 cut(s)	192
SmoI	CTYRAG	1 cut(s)	192
SpeI	ACTAGT	3 cut(s)	140, 374, 386
Sse9I	AATT	2 cut(s)	43, 101
SspI	AATATT	1 cut(s)	327
SspMI	CTAG	6 cut(s)	33, 39, 141, 375, 381, 387
StyD4I	CCNGG	2 cut(s)	168, 367
TaaI	ACNGT	1 cut(s)	212
TasI	AATT	2 cut(s)	43, 101
TatI	WGTACW	2 cut(s)	186, 383
TfiI	GAWTC	2 cut(s)	250, 428
Tru1I	TTAA	1 cut(s)	126
Tru9I	TTAA	1 cut(s)	126
TscAI	CASTG	2 cut(s)	88, 285
TseI	GCWGC	2 cut(s)	263, 401
TspDTI	ATGAA	2 cut(s)	224, 353
TspRI	CASTG	2 cut(s)	88, 285
VpaK11BI	GGWCC	1 cut(s)	365
XceI	RCATGY	1 cut(s)	187
XspI	CTAG	6 cut(s)	33, 39, 141, 375, 381, 387
ZrmI	AGTACT	1 cut(s)	385

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.