Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8195442.1

Orthogroup ID

OG0008399

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 381

Gene Structure 381 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8195442.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 233 bp

ctagatcaaacaagtcacggtggagcacattgtggatgaagttgaagaaagagaagaagaagatttttgatcctccagcgagctctcgctctgcggagctccaatatgatcctctctcttactctcagaattttgatcaaggatgttcttgggaccaacctgatgaagatgacctttgttcgcgctcgttctccatgcgttttgcagttccgtccaagtccaacatcttttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

76

Amino Acids

8.93

Weight (kDa)

9.04

Isoelectric Point (pI)

80.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008399)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G25735
fragaria_vesca	FvH4_1g05060 FvH4_2g36280
malus_domestica	MD17G1194700.v1.1
prunus_persica	Prupe.1G454200_v2.0.a1 Prupe.3G070700_v2.0.a1 Prupe.7G229300_v2.0.a1
pyrus_communis	pycom08g10060 pycom08g10080
rosa_chinensis	RchiOBHm_Chr2g0090671 RchiOBHm_Chr2g0137921 RchiOBHm_Chr6g0305601
rosa_laevigata	RLG00000010873 RLG00000016135 RLG00000019690
rosa_multiflora	Rmu_co8195442.1_g000001
rosa_roxburghii	Rroxscaffold_2G00106650 Rroxscaffold_7G00162540
rosa_rugosa	Rorug02G0009900 Rorug02G0348100 Rorug06G0342100
rosa_samantha	Rh6AG454000
rosa_wichuraiana	Rw6G039580

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	183
AciI	CCGC	1 cut(s)	94
AclWI	GGATC	2 cut(s)	64, 103
AcsI	RAATTY	1 cut(s)	129
AdeI	CACNNNGTG	1 cut(s)	32
AgsI	TTSAA	1 cut(s)	45
AluBI	AGCT	2 cut(s)	83, 99
AluI	AGCT	2 cut(s)	83, 99
Alw21I	GWGCWC	3 cut(s)	28, 85, 101
AlwI	GGATC	2 cut(s)	64, 103
ApoI	RAATTY	1 cut(s)	129
AspLEI	GCGC	1 cut(s)	185
AspS9I	GGNCC	1 cut(s)	153
AvaII	GGWCC	1 cut(s)	153
BanII	GRGCYC	2 cut(s)	85, 101
Bbv12I	GWGCWC	3 cut(s)	28, 85, 101
BclI	TGATCA	1 cut(s)	135
BfaI	CTAG	1 cut(s)	2
Bme18I	GGWCC	1 cut(s)	153
BmgT120I	GGNCC	1 cut(s)	153
BmiI	GGNNCC	1 cut(s)	154
BpmI	CTGGAG	1 cut(s)	59
BseGI	GGATG	2 cut(s)	41, 148
BseMII	CTCAG	1 cut(s)	139
Bsh1236I	CGCG	1 cut(s)	183
BsiHKAI	GWGCWC	3 cut(s)	28, 85, 101
BslFI	GGGAC	1 cut(s)	166
BsmFI	GGGAC	1 cut(s)	166
Bsp1286I	GDGCHC	3 cut(s)	28, 85, 101
Bsp143I	GATC	4 cut(s)	4, 69, 108, 135
BspACI	CCGC	1 cut(s)	94
BspCNI	CTCAG	1 cut(s)	138
BspFNI	CGCG	1 cut(s)	183
BspLI	GGNNCC	1 cut(s)	154
BspPI	GGATC	2 cut(s)	64, 103
BssMI	GATC	4 cut(s)	4, 69, 108, 135
Bst4CI	ACNGT	1 cut(s)	20
BstC8I	GCNNGC	1 cut(s)	81
BstDEI	CTNAG	1 cut(s)	125
BstF5I	GGATG	2 cut(s)	41, 148
BstFNI	CGCG	1 cut(s)	183
BstHHI	GCGC	1 cut(s)	185
BstKTI	GATC	4 cut(s)	7, 72, 111, 138
BstMBI	GATC	4 cut(s)	4, 69, 108, 135
BstUI	CGCG	1 cut(s)	183
BtsCI	GGATG	2 cut(s)	41, 148
Cac8I	GCNNGC	1 cut(s)	81
CfoI	GCGC	1 cut(s)	185
Cfr13I	GGNCC	1 cut(s)	153
CviAII	CATG	1 cut(s)	195
CviJI	RGCY	2 cut(s)	83, 99
CviKI_1	RGCY	2 cut(s)	83, 99
DdeI	CTNAG	1 cut(s)	125
DpnI	GATC	4 cut(s)	6, 71, 110, 137
DpnII	GATC	4 cut(s)	4, 69, 108, 135
DraIII	CACNNNGTG	1 cut(s)	32
Ecl136II	GAGCTC	2 cut(s)	83, 99
Eco24I	GRGCYC	2 cut(s)	85, 101
Eco47I	GGWCC	1 cut(s)	153
Eco53kI	GAGCTC	2 cut(s)	83, 99
EcoICRI	GAGCTC	2 cut(s)	83, 99
EcoT38I	GRGCYC	2 cut(s)	85, 101
FaeI	CATG	1 cut(s)	198
FaiI	YATR	2 cut(s)	107, 196
FalI	AAGNNNNNCTT	2 cut(s)	158, 190
FaqI	GGGAC	1 cut(s)	166
FatI	CATG	1 cut(s)	194
FbaI	TGATCA	1 cut(s)	135
FokI	GGATG	2 cut(s)	48, 155
FriOI	GRGCYC	2 cut(s)	85, 101
FspBI	CTAG	1 cut(s)	2
GlaI	GCGC	1 cut(s)	184
GsuI	CTGGAG	1 cut(s)	59
HhaI	GCGC	1 cut(s)	185
Hin1II	CATG	1 cut(s)	198
Hin6I	GCGC	1 cut(s)	183
HinP1I	GCGC	1 cut(s)	183
Hpy188I	TCNGA	1 cut(s)	128
HpyCH4III	ACNGT	1 cut(s)	20
HpyCH4V	TGCA	1 cut(s)	205
HpyF3I	CTNAG	1 cut(s)	125
Hsp92II	CATG	1 cut(s)	198
HspAI	GCGC	1 cut(s)	183
Ksp22I	TGATCA	1 cut(s)	135
Kzo9I	GATC	4 cut(s)	4, 69, 108, 135
LmnI	GCTCC	3 cut(s)	23, 96, 104
LpnPI	CCDG	2 cut(s)	89, 173
MaeI	CTAG	1 cut(s)	2
MaeIII	GTNAC	1 cut(s)	14
MalI	GATC	4 cut(s)	6, 71, 110, 137
MboI	GATC	4 cut(s)	4, 69, 108, 135
MboII	GAAGA	5 cut(s)	57, 66, 69, 72, 178
MhlI	GDGCHC	3 cut(s)	28, 85, 101
MluCI	AATT	1 cut(s)	129
MnlI	CCTC	2 cut(s)	83, 122
MvnI	CGCG	1 cut(s)	183
NdeII	GATC	4 cut(s)	4, 69, 108, 135
NlaIII	CATG	1 cut(s)	198
NlaIV	GGNNCC	1 cut(s)	154
NmuCI	GTSAC	1 cut(s)	14
Psp124BI	GAGCTC	2 cut(s)	85, 101
PspN4I	GGNNCC	1 cut(s)	154
PspPI	GGNCC	1 cut(s)	153
SacI	GAGCTC	2 cut(s)	85, 101
Sau3AI	GATC	4 cut(s)	4, 69, 108, 135
Sau96I	GGNCC	1 cut(s)	153
SduI	GDGCHC	3 cut(s)	28, 85, 101
SetI	ASST	4 cut(s)	85, 101, 162, 176
SinI	GGWCC	1 cut(s)	153
Sse9I	AATT	1 cut(s)	129
SsiI	CCGC	1 cut(s)	94
SspMI	CTAG	1 cut(s)	2
SstI	GAGCTC	2 cut(s)	85, 101
TaaI	ACNGT	1 cut(s)	20
TasI	AATT	1 cut(s)	129
TseFI	GTSAC	1 cut(s)	14
Tsp45I	GTSAC	1 cut(s)	14
TspDTI	ATGAA	2 cut(s)	52, 179
TspGWI	ACGGA	1 cut(s)	200
VpaK11BI	GGWCC	1 cut(s)	153
XapI	RAATTY	1 cut(s)	129
XspI	CTAG	1 cut(s)	2

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.