Rmu_co8199028.1_g000001

H ACA ribonucleoprotein complex non-core subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8199028.1
OG0012463
Physical Location & Seq
Reverse (-)
69 .. 602
534 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8199028.1_g000001.1.cds

Sequence Viewer

Length: 534 bp
atgtctgtgccgggcggaattccattccatcagcagacaaatgtattttctggacccatgggttcacaagggatgatgggtcaacttggcttccaccaaccagcatttggagtaggtttccagggacaacctacaccaggtcaacagttgaattcctttccaggacccatgaatgcatttgggatgagtcaacagggtcaacatgggttcaaccaaaatgcatttgggatgggtcaacagggattcaacccaaatgtttttggggtaggtcaacagggtcaacatggcttcaacccaaatgcgtttgcgatagttcaacagggtcagcatggcttcaaccaaaatacattcgggataggctcacagggtcaacctacaaacctaagcttagaacagaatatgccacaacctgggaacccggttgtaggtgatactgacgctccccaacaatttagtcgaagtacatctgctaatcgtggaagaagaccatttcgtcgagggggtcgtcagggaagaggaagaggttctaggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000154 GO:0000454 GO:0000491 GO:0000493 GO:0001522 GO:0003674 GO:0003676 GO:0003723 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005732 GO:0005737 GO:0006139 GO:0006364 GO:0006396 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009889 GO:0009891 GO:0009892 GO:0009893 GO:0009894 GO:0009895 GO:0009987 GO:0010467 GO:0010468 GO:0010556 GO:0010557 GO:0010604 GO:0010605 GO:0010608 GO:0010638 GO:0016043 GO:0016070 GO:0016072 GO:0016074 GO:0019219 GO:0019222 GO:0022607 GO:0022613 GO:0022618 GO:0031118 GO:0031323 GO:0031324 GO:0031325 GO:0031326 GO:0031328 GO:0031329 GO:0031330 GO:0032204 GO:0032206 GO:0032210 GO:0032212 GO:0032991 GO:0033043 GO:0033044 GO:0034470 GO:0034622 GO:0034641 GO:0034660 GO:0042254 GO:0043085 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0043487 GO:0043489 GO:0043933 GO:0044085 GO:0044093 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0045934 GO:0045935 GO:0046483 GO:0048518 GO:0048519 GO:0048522 GO:0048523 GO:0050789 GO:0050790 GO:0050794 GO:0051052 GO:0051054 GO:0051128 GO:0051130 GO:0051171 GO:0051172 GO:0051173 GO:0051252 GO:0051253 GO:0051338 GO:0051347 GO:0051972 GO:0051973 GO:0060255 GO:0065003 GO:0065007 GO:0065008 GO:0065009 GO:0070034 GO:0071704 GO:0071826 GO:0071840 GO:0080090 GO:0090304 GO:0090669 GO:0097159 GO:1901360 GO:1901363 GO:1902369 GO:1904356 GO:1904358 GO:1905323 GO:1990904 GO:2000112 GO:2000278 GO:2000573 GO:2001252
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Gar1

Protein Analysis

177

Amino Acids

18.8

Weight (kDa)

12.0

Isoelectric Point (pI)

45.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012463)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G03530
fragaria_vesca FvH4_6g44910
malus_domestica MD09G1092000.v1.1 MD17G1081900.v1.1
prunus_persica Prupe.3G233000_v2.0.a1
pyrus_communis pycom09g01750 pycom17g08010
rosa_chinensis RchiOBHm_Chr2g0162091
rosa_laevigata RLG00000021322
rosa_multiflora Rmu_co8199028.1_g000001 Rmu_co8200688.1_g000001 Rmu_sc0004020.1_g000037
rosa_roxburghii Rroxscaffold_2G00088310
rosa_rugosa Rorug02G0494600
rosa_samantha Rh2AG560800 Rh2BG574100 Rh2CG544400 Rh2DG584100
rosa_wichuraiana Rw2G046450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 492
AccB7I CCANNNNNTGG 2 cut(s) 107, 410
AciI CCGC 1 cut(s) 15
AcsI RAATTY 2 cut(s) 18, 151
AfaI GTAC 1 cut(s) 463
AfiI CCNNNNNNNGG 4 cut(s) 107, 137, 410, 425
AgsI TTSAA 6 cut(s) 151, 211, 247, 292, 317, 337
AjnI CCWGG 4 cut(s) 120, 136, 160, 409
AluBI AGCT 1 cut(s) 387
AluI AGCT 1 cut(s) 387
ApoI RAATTY 2 cut(s) 18, 151
Asp700I GAANNNNTTC 1 cut(s) 523
AspS9I GGNCC 2 cut(s) 53, 164
AsuC2I CCSGG 2 cut(s) 12, 419
AsuHPI GGTGA 1 cut(s) 440
AvaII GGWCC 2 cut(s) 53, 164
BbsI GAAGAC 1 cut(s) 490
BccI CCATC 3 cut(s) 36, 70, 223
BciT130I CCWGG 4 cut(s) 122, 138, 162, 411
BcnI CCSGG 2 cut(s) 12, 419
BfaI CTAG 1 cut(s) 528
Bme1390I CCNGG 6 cut(s) 12, 122, 138, 162, 411, 419
Bme18I GGWCC 2 cut(s) 53, 164
BmgT120I GGNCC 2 cut(s) 53, 164
BmiI GGNNCC 3 cut(s) 55, 166, 416
BmrFI CCNGG 6 cut(s) 12, 122, 138, 162, 411, 419
BpiI GAAGAC 1 cut(s) 490
Bpu10I CCTNAGC 1 cut(s) 383
BpuMI CCSGG 2 cut(s) 12, 419
BsaJI CCNNGG 3 cut(s) 57, 121, 410
BsaXI ACNNNNNCTCC 2 cut(s) 424, 454
Bsc4I CCNNNNNNNGG 4 cut(s) 107, 137, 410, 425
BseBI CCWGG 4 cut(s) 122, 138, 162, 411
BseDI CCNNGG 3 cut(s) 57, 121, 410
BseGI GGATG 3 cut(s) 78, 189, 234
BseLI CCNNNNNNNGG 4 cut(s) 107, 137, 410, 425
BsiSI CCGG 2 cut(s) 11, 419
BslFI GGGAC 1 cut(s) 138
BslI CCNNNNNNNGG 4 cut(s) 107, 137, 410, 425
BsmFI GGGAC 1 cut(s) 138
BsmI GAATGC 1 cut(s) 178
Bsp19I CCATGG 1 cut(s) 57
BspACI CCGC 1 cut(s) 15
BspLI GGNNCC 3 cut(s) 55, 166, 416
BssECI CCNNGG 3 cut(s) 57, 121, 410
BssT1I CCWWGG 1 cut(s) 57
Bst2UI CCWGG 4 cut(s) 122, 138, 162, 411
Bst4CI ACNGT 1 cut(s) 147
Bst6I CTCTTC 2 cut(s) 508, 514
BstDEI CTNAG 2 cut(s) 383, 388
BstDSI CCRYGG 1 cut(s) 57
BstENI CCTNNNNNAGG 1 cut(s) 135
BstF5I GGATG 3 cut(s) 78, 189, 234
BstNI CCWGG 4 cut(s) 122, 138, 162, 411
BstSCI CCNGG 6 cut(s) 10, 120, 136, 160, 409, 417
BstV2I GAAGAC 1 cut(s) 490
BtgI CCRYGG 1 cut(s) 57
BtsCI GGATG 3 cut(s) 78, 189, 234
Cfr13I GGNCC 2 cut(s) 53, 164
CseI GACGC 1 cut(s) 446
CsiI ACCWGGT 1 cut(s) 136
Csp6I GTAC 1 cut(s) 462
CviAII CATG 5 cut(s) 58, 169, 203, 284, 329
CviJI RGCY 5 cut(s) 90, 288, 333, 360, 387
CviKI_1 RGCY 5 cut(s) 90, 288, 333, 360, 387
CviQI GTAC 1 cut(s) 462
DdeI CTNAG 2 cut(s) 383, 388
DrdI GACNNNNNNGTC 1 cut(s) 492
DseDI GACNNNNNNGTC 1 cut(s) 492
Eam1104I CTCTTC 2 cut(s) 508, 514
EarI CTCTTC 2 cut(s) 508, 514
EciI GGCGGA 1 cut(s) 30
Eco130I CCWWGG 1 cut(s) 57
Eco47I GGWCC 2 cut(s) 53, 164
EcoNI CCTNNNNNAGG 1 cut(s) 135
EcoO109I RGGNCCY 1 cut(s) 164
EcoRI GAATTC 2 cut(s) 18, 151
EcoRII CCWGG 4 cut(s) 120, 136, 160, 409
EcoT14I CCWWGG 1 cut(s) 57
EcoT22I ATGCAT 2 cut(s) 178, 223
ErhI CCWWGG 1 cut(s) 57
FaeI CATG 5 cut(s) 61, 172, 206, 287, 332
FaiI YATR 6 cut(s) 59, 170, 204, 285, 330, 401
FaqI GGGAC 1 cut(s) 138
FatI CATG 5 cut(s) 57, 168, 202, 283, 328
FokI GGATG 3 cut(s) 85, 196, 241
FspBI CTAG 1 cut(s) 528
HapII CCGG 2 cut(s) 11, 419
HgaI GACGC 1 cut(s) 446
Hin1II CATG 5 cut(s) 61, 172, 206, 287, 332
HincII GTYRAC 8 cut(s) 83, 143, 191, 200, 236, 272, 281, 371
HindII GTYRAC 8 cut(s) 83, 143, 191, 200, 236, 272, 281, 371
HindIII AAGCTT 1 cut(s) 385
HinfI GANTC 2 cut(s) 187, 243
HpaII CCGG 2 cut(s) 11, 419
HphI GGTGA 1 cut(s) 440
Hpy166II GTNNAC 9 cut(s) 65, 83, 143, 191, 200, 236, 272, 281, 371
Hpy188III TCNNGA 2 cut(s) 51, 352
Hpy8I GTNNAC 9 cut(s) 65, 83, 143, 191, 200, 236, 272, 281, 371
Hpy99I CGWCG 1 cut(s) 498
HpyCH4III ACNGT 1 cut(s) 147
HpyCH4V TGCA 2 cut(s) 176, 221
HpyF3I CTNAG 2 cut(s) 383, 388
Hsp92II CATG 5 cut(s) 61, 172, 206, 287, 332
LmnI GCTCC 1 cut(s) 445
MabI ACCWGGT 1 cut(s) 136
MaeI CTAG 1 cut(s) 528
MboII GAAGA 4 cut(s) 492, 495, 525, 531
MluCI AATT 3 cut(s) 18, 151, 449
MlyI GAGTC 1 cut(s) 196
MnlI CCTC 3 cut(s) 491, 509, 515
Mph1103I ATGCAT 2 cut(s) 178, 223
MroXI GAANNNNTTC 1 cut(s) 523
MspI CCGG 2 cut(s) 11, 419
MspR9I CCNGG 6 cut(s) 12, 122, 138, 162, 411, 419
Mva1269I GAATGC 1 cut(s) 178
MvaI CCWGG 4 cut(s) 122, 138, 162, 411
NciI CCSGG 2 cut(s) 12, 419
NcoI CCATGG 1 cut(s) 57
NlaIII CATG 5 cut(s) 61, 172, 206, 287, 332
NlaIV GGNNCC 3 cut(s) 55, 166, 416
NsiI ATGCAT 2 cut(s) 178, 223
PcsI WCGNNNNNNNCGW 1 cut(s) 502
PctI GAATGC 1 cut(s) 178
PdmI GAANNNNTTC 1 cut(s) 523
PfeI GAWTC 1 cut(s) 243
PflMI CCANNNNNTGG 2 cut(s) 107, 410
PfoI TCCNGGA 1 cut(s) 160
PleI GAGTC 1 cut(s) 195
PpsI GAGTC 1 cut(s) 195
PpuMI RGGWCCY 1 cut(s) 164
Psp5II RGGWCCY 1 cut(s) 164
Psp6I CCWGG 4 cut(s) 120, 136, 160, 409
PspGI CCWGG 4 cut(s) 120, 136, 160, 409
PspN4I GGNNCC 3 cut(s) 55, 166, 416
PspPI GGNCC 2 cut(s) 53, 164
PspPPI RGGWCCY 1 cut(s) 164
RsaI GTAC 1 cut(s) 463
RsaNI GTAC 1 cut(s) 462
Sau96I GGNCC 2 cut(s) 53, 164
SchI GAGTC 1 cut(s) 196
ScrFI CCNGG 6 cut(s) 12, 122, 138, 162, 411, 419
SexAI ACCWGGT 1 cut(s) 136
SinI GGWCC 2 cut(s) 53, 164
Sse9I AATT 3 cut(s) 18, 151, 449
SsiI CCGC 1 cut(s) 15
SspMI CTAG 1 cut(s) 528
StyD4I CCNGG 6 cut(s) 10, 120, 136, 160, 409, 417
StyI CCWWGG 1 cut(s) 57
TaaI ACNGT 1 cut(s) 147
TaqI TCGA 2 cut(s) 457, 496
TasI AATT 3 cut(s) 18, 151, 449
TatI WGTACW 1 cut(s) 461
TfiI GAWTC 1 cut(s) 243
TspDTI ATGAA 1 cut(s) 185
Van91I CCANNNNNTGG 2 cut(s) 107, 410
VpaK11BI GGWCC 2 cut(s) 53, 164
XagI CCTNNNNNAGG 1 cut(s) 135
XapI RAATTY 2 cut(s) 18, 151
XcmI CCANNNNNNNNNTGG 2 cut(s) 104, 221
XmnI GAANNNNTTC 1 cut(s) 523
XspI CTAG 1 cut(s) 528
Zsp2I ATGCAT 2 cut(s) 178, 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.