Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8237059.1

Orthogroup ID

OG0006555

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 766

Gene Structure 766 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8237059.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 667 bp

attcacgacggaagtgaatctgttagtggccgtcattctggagtcaccttaaatgacacttctagccatggtagggtatccattgattctcgtgaatcagtgagttttggaagctcagatgcgggtgcagaacgtgcaaatatgcaactaagaacaagtacagcagatggttttcgagttagtgtttcaagcactcctagctgctcaagtggagggtctggacctgatgacatagaatcactaggagatgtttatgtgtggggagagatctggtctgatggaaatgtacctgatgggtctgcaaatgtaatacctataaacactgatgtgcttattccaaagcccttggagtcgaatgttgttcttgatgttcatcaaattgcttgtggtgttagacatattgctcttgtaacaaggcaaggtgaagttttcacctggggagaggaatctggtggaagacttggtcatgggattgatagagactttagtcgccctcgccttgttgagttcctggctcttaataatgtagaatttgttgcatgtggcgagtatcattcatgtgctgtatctacgtctggtgatttatttacttggggtgatggtacacataatgctggacttcttggtcatggtactgatgttagccactggctacctaaaaggatta

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005085 GO:0005086 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0005829 GO:0008150 GO:0012505 GO:0016020 GO:0019899 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0051020 GO:0065007 GO:0065009 GO:0098772

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

BRX BRX_N FYVE PH_12 RCC1

Protein Analysis

222

Amino Acids

23.53

Weight (kDa)

4.95

Isoelectric Point (pI)

33.94

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006555)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G23270 AT3G23270 AT4G14368 AT4G14368 AT4G14368 AT4G14368
fragaria_vesca	FvH4_4g03710 FvH4_4g03710 FvH4_4g03710
malus_domestica	MD13G1214600.v1.1 MD16G1219800.v1.1
prunus_persica	Prupe.1G040100_v2.0.a1 Prupe.1G040100_v2.0.a1
pyrus_communis	pycom13g18810 pycom16g18300
rosa_chinensis	RchiOBHm_Chr4g0393321
rosa_laevigata	RLG00000009764
rosa_multiflora	Rmu_co8237059.1_g000001 Rmu_sc0001590.1_g000009
rosa_roxburghii	Rroxscaffold_5G00338310
rosa_rugosa	Rorug04G0001800
rosa_samantha	Rh4AG046700 Rh4BG042300 Rh4CG049800 Rh4DG044100
rosa_wichuraiana	Rw4G003690

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	624
AciI	CCGC	1 cut(s)	122
AcoI	YGGCCR	1 cut(s)	28
AcsI	RAATTY	1 cut(s)	530
AfaI	GTAC	4 cut(s)	160, 288, 604, 634
AfiI	CCNNNNNNNGG	1 cut(s)	73
AgsI	TTSAA	1 cut(s)	189
AjnI	CCWGG	2 cut(s)	434, 510
AleI	CACNNNNGTG	1 cut(s)	326
AluBI	AGCT	2 cut(s)	114, 201
AluI	AGCT	2 cut(s)	114, 201
Alw26I	GTCTC	1 cut(s)	474
AoxI	GGCC	1 cut(s)	28
ApeKI	GCWGC	1 cut(s)	201
ApoI	RAATTY	1 cut(s)	530
AspS9I	GGNCC	1 cut(s)	221
AsuHPI	GGTGA	5 cut(s)	37, 424, 434, 590, 608
AvaII	GGWCC	1 cut(s)	221
BaeI	ACNNNNGTAYC	2 cut(s)	624, 657
BauI	CACGAG	1 cut(s)	90
BbsI	GAAGAC	1 cut(s)	463
BbvI	GCAGC	1 cut(s)	188
BccI	CCATC	4 cut(s)	161, 272, 287, 593
BceAI	ACGGC	1 cut(s)	15
BciT130I	CCWGG	2 cut(s)	436, 512
BciVI	GTATCC	1 cut(s)	88
BcoDI	GTCTC	1 cut(s)	474
BfaI	CTAG	3 cut(s)	63, 198, 242
BfuI	GTATCC	1 cut(s)	88
BglII	AGATCT	1 cut(s)	267
BisI	GCNGC	1 cut(s)	202
BlsI	GCNGC	1 cut(s)	203
Bme1390I	CCNGG	2 cut(s)	436, 512
Bme18I	GGWCC	1 cut(s)	221
BmgT120I	GGNCC	1 cut(s)	221
BmrFI	CCNGG	2 cut(s)	436, 512
BmsI	GCATC	1 cut(s)	109
BoxI	GACNNNNGTC	1 cut(s)	486
BpiI	GAAGAC	1 cut(s)	463
BpmI	CTGGAG	1 cut(s)	60
BpuEI	CTTGAG	1 cut(s)	190
BsaBI	GATNNNNATC	1 cut(s)	372
BsaJI	CCNNGG	3 cut(s)	67, 345, 435
Bsc4I	CCNNNNNNNGG	1 cut(s)	73
Bse1I	ACTGG	1 cut(s)	653
Bse8I	GATNNNNATC	1 cut(s)	372
BseBI	CCWGG	2 cut(s)	436, 512
BseDI	CCNNGG	3 cut(s)	67, 345, 435
BseJI	GATNNNNATC	1 cut(s)	372
BseLI	CCNNNNNNNGG	1 cut(s)	73
BseMII	CTCAG	1 cut(s)	129
BseNI	ACTGG	1 cut(s)	653
BseXI	GCAGC	1 cut(s)	188
BsgI	GTGCAG	1 cut(s)	147
BshFI	GGCC	1 cut(s)	30
BslI	CCNNNNNNNGG	1 cut(s)	73
BsmAI	GTCTC	1 cut(s)	474
BsnI	GGCC	1 cut(s)	30
Bsp143I	GATC	1 cut(s)	267
Bsp19I	CCATGG	1 cut(s)	67
BspACI	CCGC	1 cut(s)	122
BspANI	GGCC	1 cut(s)	30
BspCNI	CTCAG	1 cut(s)	128
BsrI	ACTGG	1 cut(s)	653
BssECI	CCNNGG	3 cut(s)	67, 345, 435
BssMI	GATC	1 cut(s)	267
BssSI	CACGAG	1 cut(s)	90
BssT1I	CCWWGG	2 cut(s)	67, 345
Bst2BI	CACGAG	1 cut(s)	90
Bst2UI	CCWGG	2 cut(s)	436, 512
BstAPI	GCANNNNNTGC	1 cut(s)	134
BstDEI	CTNAG	2 cut(s)	115, 149
BstDSI	CCRYGG	1 cut(s)	67
BstKTI	GATC	1 cut(s)	270
BstMAI	GTCTC	1 cut(s)	474
BstMBI	GATC	1 cut(s)	267
BstMWI	GCNNNNNNNGC	2 cut(s)	134, 198
BstNI	CCWGG	2 cut(s)	436, 512
BstNSI	RCATGY	1 cut(s)	543
BstPAI	GACNNNNGTC	1 cut(s)	486
BstSCI	CCNGG	2 cut(s)	434, 510
BstV1I	GCAGC	1 cut(s)	188
BstV2I	GAAGAC	1 cut(s)	463
BstX2I	RGATCY	1 cut(s)	267
BstYI	RGATCY	1 cut(s)	267
BsuI	GTATCC	1 cut(s)	88
BsuRI	GGCC	1 cut(s)	30
BtgI	CCRYGG	1 cut(s)	67
BtsIMutI	CAGTG	3 cut(s)	105, 321, 646
Cfr13I	GGNCC	1 cut(s)	221
Csp6I	GTAC	4 cut(s)	159, 287, 603, 633
CviAII	CATG	5 cut(s)	68, 467, 540, 558, 629
CviJI	RGCY	8 cut(s)	30, 66, 114, 201, 343, 515, 645, 652
CviKI_1	RGCY	8 cut(s)	30, 66, 114, 201, 343, 515, 645, 652
CviQI	GTAC	4 cut(s)	159, 287, 603, 633
DdeI	CTNAG	2 cut(s)	115, 149
DpnI	GATC	1 cut(s)	269
DpnII	GATC	1 cut(s)	267
DrdI	GACNNNNNNGTC	1 cut(s)	624
DseDI	GACNNNNNNGTC	1 cut(s)	624
EaeI	YGGCCR	1 cut(s)	28
Eco130I	CCWWGG	2 cut(s)	67, 345
Eco47I	GGWCC	1 cut(s)	221
EcoRII	CCWGG	2 cut(s)	434, 510
EcoT14I	CCWWGG	2 cut(s)	67, 345
ErhI	CCWWGG	2 cut(s)	67, 345
FaeI	CATG	5 cut(s)	71, 470, 543, 561, 632
FatI	CATG	5 cut(s)	67, 466, 539, 557, 628
FauI	CCCGC	1 cut(s)	115
Fnu4HI	GCNGC	1 cut(s)	202
Fsp4HI	GCNGC	1 cut(s)	202
FspBI	CTAG	3 cut(s)	63, 198, 242
GluI	GCNGC	1 cut(s)	202
GsuI	CTGGAG	1 cut(s)	60
HaeIII	GGCC	1 cut(s)	30
Hin1II	CATG	5 cut(s)	71, 470, 543, 561, 632
HinfI	GANTC	7 cut(s)	17, 42, 86, 95, 236, 350, 446
HphI	GGTGA	5 cut(s)	37, 424, 434, 590, 608
Hpy166II	GTNNAC	1 cut(s)	605
Hpy188I	TCNGA	2 cut(s)	118, 277
Hpy188III	TCNNGA	5 cut(s)	5, 39, 92, 219, 365
Hpy8I	GTNNAC	1 cut(s)	605
Hpy99I	CGWCG	1 cut(s)	11
HpyCH4IV	ACGT	2 cut(s)	133, 572
HpyCH4V	TGCA	5 cut(s)	128, 137, 145, 302, 539
HpyF10VI	GCNNNNNNNGC	2 cut(s)	134, 198
HpyF3I	CTNAG	2 cut(s)	115, 149
HpySE526I	ACGT	2 cut(s)	133, 572
Hsp92II	CATG	5 cut(s)	71, 470, 543, 561, 632
Kzo9I	GATC	1 cut(s)	267
Lsp1109I	GCAGC	1 cut(s)	188
LweI	GCATC	1 cut(s)	109
MaeI	CTAG	3 cut(s)	63, 198, 242
MaeII	ACGT	2 cut(s)	133, 572
MaeIII	GTNAC	2 cut(s)	43, 409
MalI	GATC	1 cut(s)	269
MboI	GATC	1 cut(s)	267
MboII	GAAGA	1 cut(s)	468
MflI	RGATCY	1 cut(s)	267
MluCI	AATT	2 cut(s)	378, 530
MlyI	GAGTC	2 cut(s)	51, 359
MnlI	CCTC	3 cut(s)	206, 436, 504
MseI	TTAA	2 cut(s)	50, 519
MslI	CAYNNNNRTG	2 cut(s)	326, 558
MspR9I	CCNGG	2 cut(s)	436, 512
MvaI	CCWGG	2 cut(s)	436, 512
MwoI	GCNNNNNNNGC	2 cut(s)	134, 198
NcoI	CCATGG	1 cut(s)	67
NdeII	GATC	1 cut(s)	267
NlaIII	CATG	5 cut(s)	71, 470, 543, 561, 632
NmuCI	GTSAC	1 cut(s)	43
NspI	RCATGY	1 cut(s)	543
OliI	CACNNNNGTG	1 cut(s)	326
PfeI	GAWTC	5 cut(s)	17, 86, 95, 236, 446
PflFI	GACNNNGTC	1 cut(s)	462
PkrI	GCNGC	1 cut(s)	203
PleI	GAGTC	2 cut(s)	50, 358
PpsI	GAGTC	2 cut(s)	50, 358
PshAI	GACNNNNGTC	1 cut(s)	486
Psp6I	CCWGG	2 cut(s)	434, 510
PspGI	CCWGG	2 cut(s)	434, 510
PspPI	GGNCC	1 cut(s)	221
PsuI	RGATCY	1 cut(s)	267
PsyI	GACNNNGTC	1 cut(s)	462
RsaI	GTAC	4 cut(s)	160, 288, 604, 634
RsaNI	GTAC	4 cut(s)	159, 287, 603, 633
RseI	CAYNNNNRTG	2 cut(s)	326, 558
SaqAI	TTAA	2 cut(s)	50, 519
SatI	GCNGC	1 cut(s)	202
Sau3AI	GATC	1 cut(s)	267
Sau96I	GGNCC	1 cut(s)	221
SchI	GAGTC	2 cut(s)	51, 359
ScrFI	CCNGG	2 cut(s)	436, 512
SfaNI	GCATC	1 cut(s)	109
SinI	GGWCC	1 cut(s)	221
SmiMI	CAYNNNNRTG	2 cut(s)	326, 558
SmlI	CTYRAG	1 cut(s)	205
SmoI	CTYRAG	1 cut(s)	205
Sse9I	AATT	2 cut(s)	378, 530
SsiI	CCGC	1 cut(s)	122
SspMI	CTAG	3 cut(s)	63, 198, 242
StyD4I	CCNGG	2 cut(s)	434, 510
StyI	CCWWGG	2 cut(s)	67, 345
TaiI	ACGT	2 cut(s)	136, 575
TaqI	TCGA	2 cut(s)	175, 353
TasI	AATT	2 cut(s)	378, 530
TatI	WGTACW	1 cut(s)	158
TfiI	GAWTC	5 cut(s)	17, 86, 95, 236, 446
Tru1I	TTAA	2 cut(s)	50, 519
Tru9I	TTAA	2 cut(s)	50, 519
TscAI	CASTG	3 cut(s)	105, 328, 653
TseFI	GTSAC	1 cut(s)	43
TseI	GCWGC	1 cut(s)	201
Tsp45I	GTSAC	1 cut(s)	43
TspDTI	ATGAA	2 cut(s)	362, 546
TspGWI	ACGGA	1 cut(s)	24
TspRI	CASTG	3 cut(s)	105, 328, 653
Tth111I	GACNNNGTC	1 cut(s)	462
VpaK11BI	GGWCC	1 cut(s)	221
XapI	RAATTY	1 cut(s)	530
XceI	RCATGY	1 cut(s)	543
XspI	CTAG	3 cut(s)	63, 198, 242

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.