Rmu_co8237653.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8237653.1
Physical Location & Seq
Forward (+)
1 .. 580
580 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8237653.1_g000001.1.cds

Sequence Viewer

Length: 468 bp
tcaacactccgaacgcagttgcttgaaatagagcatctaaaggaggaggtggaaaaccatgtcagagatggacaagatactgagaagatgaaaaatgaactgtctgtgctgatatatgctttgcaaaaaattatagatatgtcgggaggcgatgatttagttggagacgagaagtctgctggtgtgaagggacttgtgtcggtgttagagaagcaggttatggctttgctaattgaatctaaaaattcaaaatcaaaagctcaggaacttggcactaagttggtcgagagccaaaaggttgtggatgaattatcaaccaaggttaatttacttgaagtttcagctcaaggaagggttgctcagccagagattgtccaggaaaggagcatttttgaagcaccatccttgcctactggttcagagatatctgaaattgaagatgtggcgattgcggttttggctcattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

155

Amino Acids

16.93

Weight (kDa)

4.74

Isoelectric Point (pI)

50.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 205
AciI CCGC 1 cut(s) 452
AcsI RAATTY 1 cut(s) 244
AgsI TTSAA 6 cut(s) 26, 236, 249, 335, 395, 437
AhdI GACNNNNNGTC 1 cut(s) 172
AjnI CCWGG 1 cut(s) 375
AluBI AGCT 2 cut(s) 260, 344
AluI AGCT 2 cut(s) 260, 344
Alw26I GTCTC 1 cut(s) 159
ApoI RAATTY 1 cut(s) 244
BccI CCATC 2 cut(s) 62, 409
BcgI CGANNNNNNTGC 2 cut(s) 158, 192
BciT130I CCWGG 1 cut(s) 377
BcoDI GTCTC 1 cut(s) 159
BfuAI ACCTGC 1 cut(s) 205
BlpI GCTNAGC 1 cut(s) 360
Bme1390I CCNGG 1 cut(s) 377
BmeRI GACNNNNNGTC 1 cut(s) 172
BmrFI CCNGG 1 cut(s) 377
BmsI GCATC 1 cut(s) 43
BoxI GACNNNNGTC 1 cut(s) 196
Bpu10I CCTNAGC 1 cut(s) 261
Bpu1102I GCTNAGC 1 cut(s) 360
BpuEI CTTGAG 1 cut(s) 330
BsaJI CCNNGG 1 cut(s) 318
Bse1I ACTGG 1 cut(s) 418
BseBI CCWGG 1 cut(s) 377
BseDI CCNNGG 1 cut(s) 318
BseGI GGATG 2 cut(s) 310, 401
BseMII CTCAG 3 cut(s) 72, 275, 374
BseNI ACTGG 1 cut(s) 418
BseRI GAGGAG 1 cut(s) 59
BslFI GGGAC 1 cut(s) 204
BsmAI GTCTC 1 cut(s) 159
BsmBI CGTCTC 1 cut(s) 159
BsmFI GGGAC 1 cut(s) 204
Bsp1720I GCTNAGC 1 cut(s) 360
BspACI CCGC 1 cut(s) 452
BspCNI CTCAG 3 cut(s) 73, 274, 373
BspMI ACCTGC 1 cut(s) 205
BsrI ACTGG 1 cut(s) 418
BssECI CCNNGG 1 cut(s) 318
BssT1I CCWWGG 1 cut(s) 318
Bst2UI CCWGG 1 cut(s) 377
Bst4CI ACNGT 1 cut(s) 102
BstDEI CTNAG 4 cut(s) 81, 261, 276, 360
BstF5I GGATG 2 cut(s) 310, 401
BstMAI GTCTC 1 cut(s) 159
BstMWI GCNNNNNNNGC 1 cut(s) 458
BstNI CCWGG 1 cut(s) 377
BstPAI GACNNNNGTC 1 cut(s) 196
BstSCI CCNGG 1 cut(s) 375
BtgZI GCGATG 1 cut(s) 165
BtsCI GGATG 2 cut(s) 310, 401
BveI ACCTGC 1 cut(s) 205
CviAII CATG 1 cut(s) 59
CviJI RGCY 6 cut(s) 224, 260, 291, 344, 364, 461
CviKI_1 RGCY 6 cut(s) 224, 260, 291, 344, 364, 461
DdeI CTNAG 4 cut(s) 81, 261, 276, 360
DriI GACNNNNNGTC 1 cut(s) 172
Eam1105I GACNNNNNGTC 1 cut(s) 172
Eco130I CCWWGG 1 cut(s) 318
Eco32I GATATC 1 cut(s) 426
EcoRII CCWGG 1 cut(s) 375
EcoRV GATATC 1 cut(s) 426
EcoT14I CCWWGG 1 cut(s) 318
ErhI CCWWGG 1 cut(s) 318
Esp3I CGTCTC 1 cut(s) 159
FaeI CATG 1 cut(s) 62
FaiI YATR 6 cut(s) 60, 115, 117, 134, 140, 221
FaqI GGGAC 1 cut(s) 204
FatI CATG 1 cut(s) 58
FokI GGATG 2 cut(s) 317, 388
Hin1II CATG 1 cut(s) 62
HinfI GANTC 1 cut(s) 236
Hpy188I TCNGA 4 cut(s) 11, 65, 421, 430
Hpy188III TCNNGA 3 cut(s) 144, 263, 286
HpyAV CCTTC 2 cut(s) 181, 345
HpyCH4III ACNGT 1 cut(s) 102
HpyCH4V TGCA 1 cut(s) 124
HpyF10VI GCNNNNNNNGC 1 cut(s) 458
HpyF3I CTNAG 4 cut(s) 81, 261, 276, 360
Hsp92II CATG 1 cut(s) 62
LmnI GCTCC 1 cut(s) 384
LpnPI CCDG 7 cut(s) 165, 200, 248, 362, 378, 389, 399
LweI GCATC 1 cut(s) 43
MboII GAAGA 2 cut(s) 97, 449
MluCI AATT 6 cut(s) 129, 231, 244, 308, 325, 432
MmeI TCCRAC 1 cut(s) 142
MnlI CCTC 3 cut(s) 37, 40, 140
MseI TTAA 2 cut(s) 324, 466
MspR9I CCNGG 1 cut(s) 377
MvaI CCWGG 1 cut(s) 377
MwoI GCNNNNNNNGC 1 cut(s) 458
NlaIII CATG 1 cut(s) 62
PfeI GAWTC 1 cut(s) 236
PfoI TCCNGGA 1 cut(s) 375
PshAI GACNNNNGTC 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 375
PspGI CCWGG 1 cut(s) 375
SaqAI TTAA 2 cut(s) 324, 466
ScrFI CCNGG 1 cut(s) 377
SetI ASST 6 cut(s) 51, 219, 262, 300, 324, 346
SfaNI GCATC 1 cut(s) 43
SmlI CTYRAG 1 cut(s) 345
SmoI CTYRAG 1 cut(s) 345
Sse9I AATT 6 cut(s) 129, 231, 244, 308, 325, 432
SsiI CCGC 1 cut(s) 452
StyD4I CCNGG 1 cut(s) 375
StyI CCWWGG 1 cut(s) 318
TaaI ACNGT 1 cut(s) 102
TaqI TCGA 1 cut(s) 285
TasI AATT 6 cut(s) 129, 231, 244, 308, 325, 432
TfiI GAWTC 1 cut(s) 236
Tru1I TTAA 2 cut(s) 324, 466
Tru9I TTAA 2 cut(s) 324, 466
TspDTI ATGAA 3 cut(s) 104, 111, 321
XapI RAATTY 1 cut(s) 244
XcmI CCANNNNNNNNNTGG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.