Rmu_sc0004965.1_g000018

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004965.1
Physical Location & Seq
Forward (+)
112323 .. 123080
10758 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004965.1_g000018.1.cds

Sequence Viewer

Length: 7086 bp
atgtctgagaagagcgattccggccagcttccggacggtgctgcggattcgaatgcgatttggaacgacgtcgtttcaccggcgaacaaagccgaggaattggggaaagtgttggaggacgcggggtcagggaaggaggacatgttcgaagattgccccgacgatatcttggtggatgaggtcgaacgtttacgacttcagctggatactagtattgcagagaaagatgactttgctcgcaaatttaaggaagagagagagtcttttgttagagaagttggcactcttcgaattcagcttaggggtctcactgatcaacagccattggtgggtgaaaatggcggtgatttttgtaataatgaggctggaagtggagagaatggagaaaagactgcagtggtggacaagggtacgccgtggattgacttgataaaggagtgttctgggtttgttaacaaggcgttggagaaacagtctcagattgaggccagggtgagagagctcgatggaattgtgtatatgaaggatcaagaaatcgagggtctcaatgccaatgtgaaaggtttatatgagagtcaccatgagaaggatgcatattttgaagctctggcaaataggatgttggcttcccttagcggtgtagttggtcaacaagaactgctggatgattcgattggtggaaaactagtacatgttgagaatggcacgtctatgttagttgagaatttcacccggatgctttctgaaattgaacatttcagacagtgtttgcctgagaccgggtttgatcatagttcgcaggaagtggggggcatttttgctgctgctcgtaatgagttacttgagctcagaagaaaggaagcagaatttgttgaaagactgagtcttctagaagattcaaataggaaattggttgaagaactggacaatcagagagcgatagctgaaaggctgaatgcagaacttggacaaacaaaaatggagctggagcaggagaagaataggtgtgctaatactagagagaagcttactatcgctgtgcagaaaggcaagggattggtacagcaaagagactcattgaagcagtccattgctgaaaaactgagtgagcttgagaagtgtcggactgaattgcaggagaagtcaagtgctcttgaagctgctgaattaagcaaggaggaattgattaggagtgaaaactcagttgcatcactgcaagaaacactttcccaaaataatgtaattcttcagaaacttgaagaaatgttgtctcagactggtgtacctgaagagcttcaatctacggatattgtagagagacttcgatggcttatggatgaaagtgttaaactcaaggaaatttctatggaattccaaaccttgaaagatgctgtgtatgctattggtctaccagaagttatttcatcttctagtttggaatctcaagtaagttggcttcgcgaatcatattctcaggcgaatgaggaagtgcttctgctacgtaatgaaattactgcaactaaggaagtggcacataaaaatattgaccagttaactgaatcactttcagctgaattgcgggcaaaagaacatctccaagcagagttggacaacataacatcggaatacaatgagattatcaagaaagagcatcaagtgtctttagagaaagctcagatggtcagaaggttacttgatgtgtctggagttgtaatggacaatgaggatgtctctcaactttccgctgacattgccacactcattgacacatgtattgagaagataaaagaacagagctctgcttcactttcggctgaaatgcaggcaaaggaagttctccaagtggagttagacagtcttacatcaaagtacaaagagatagttgaaaaggagcgtcaagtatcttcagagaatgctgtgatggtcaaaatgttacttgatgtctctggaattgtgattgacaatgaggatgtctctcagctttcctcagacattggcacgtcagacattgccacactcattgacacatgtattgagaagataaaagaacagagctctgcttcactttcggctgaaatgcaggcaaagaaagttctccaagtggagttagacagtcttacatcaaagtacaaagagatagttgaaaaggagcgtcaagtatcttcagagaatgctgagatggtcaaaatgttacttgatgtctctggaattgtgattgacaatgaggatgtctctcagctttcctcagacattggcacgtttattgacacatgtattgggaagataaaagaacagagcagtgcttcatttgaacagtcaactgcttcgctttcagctgaaatgcaagcaaaggaatttctccaagtagagttggagagtctaacatcgaagtacaaagagattgttgagaaagagcgtcaagtgtcttcagagaaggctgagatggtcaaaatgttacttgatgtctctggaattgtgattgacaatgaagatgtctctcagctttcctcagacactgccacgctgattgatagatgcattcagaaaataaaagaacagagcagtgcctcacttgattctccaagtttcgatgtggagctatttgaaacaattcaaagccacttgtacgtaagagatcaggagttgatgctctgtcagaatattctagaagaggagatggtgatgaaatcagaggtgaataaactgtcggaggaattacgaattgtgtctcaacaagttgaggcattgaaggaggaaaaagggtccctacagagagatattgaacggtcagaacaggagaatgctatgataagggagaagttatccgtggcagtcaaggaaggtaaggaaatggttcaagagcggggaaatgcttcatttgaacagagcagtgcttcatttgaacagttaactgcttctctttcagctgaaatgcaggcaaaggaatatctccaagtagagttggagagtctaacattgaagtacaaagagattgttgagaaagagcgtcaagcgtcttcagagaaggctgagatggccaagatgttacttgatgtctctggaattgtgattgacaatgaagatgtctctcagctttcctcagaaactgccacgctcattgatagatgcattcagaagataaaagaacagagcagtgcctcacttgattctccaagtttcgatgtggagctatttgaaacaattcaaagccacttgtacgtaagagatcaggagttgatgctctgtcagaatattctagaagaggagatggtggtgaaatcagaggtgaataaactgttggaggaattacgaattgtgtctcaacaagttgaggccttgaaggaggaaaaagggtccctacagagagatattgaacggtcagaagagaagaatgctatgataagggagaagttatccatggcagtcaagaaaggtaagggaatggttcaagagcgggaaaacttgaaacttcgtgtggaagaaaagaactcggagattgagaagctaaggcttgagttacagcaggaacaatccacactgtctgaatgcagggacaagataaatagcttgtctgctgatacagactgcatcccaaagttaaaagttgatcttgttgctatgaaggaacaaagggatcaactcgaacagttcttactggagagcaataacatgttacagagagtaactaaagcgattgatgcaattgtgcttcctgttgattcttttgaagaacctttggggaaggtgaactggcttgcaggatacctgagtgaatgtcatgatgctgaggcaaaagcaaagcaagagttgggaaaagtacaagaggaaacaagtaatcttgtgtttaagttggaagaagcccattcaacaataaattcactggaaaaggaattatcagtggcggagaatagtttgtcactacttgctgaagaaaagagggaaatggaagtcagtaagaccagggttgaaaaagagttacagagagcattagaagaagctgtttcccaggctatcaagtttagcgaggtttctgcagctaaaaagtcgctggaagaggcattatcacttgcagaaaataacatatctgttcttgtcagtgaaaaggagggggctttagtcagtagagccactgcagatacagagctaggaaaggtcaaagaggaagttgatatacagaccagcaaactaacagatgcctacaagaccatagagtcacttgaagttgcactttctcaggcacaggccaacgtttctttacttactgaacaaaacaatgatgctcaaattggtagatccaatttagaggctgagctaaagaaactgcaagaggaagctaggttgcaggataacaagcttgcagatgccagtgcaaccataaataaactggaagatgcactgttgaaagcagggaatgatatatctgaacttgaaactggaaagaaaaatgctgaagaggagatattaaaactcagttccaagttaaatgcatccatcgaagagttgcctggaactaatggcaacacagaaaacaggtccttagagctcactgatcaccttgataatcttcaagtgctaatgaaggacgagactatgttgtccacaatgaaaagatgttttgagaagaagtttgagagcctgaaagatatggatctcattcttaaaaatataagagaccagtgtgtttcagggggtttagctgagctgcaaggtcagcaagtactggaggaagattcatatgtgaccaaatctttttcagatggtcttgtcaatattgtcagtgttgaaaaggacaatgctgaggtcaatggtgcagatggtaatgatataccttcatatttgaagacgactgtggaaaggttgcagttgcgtgacatggttctgtcacaaaattttgaacgcttctcttcttttatagatgagtttattgaaactctgttaagaaatttacaggcacgaagtgatgaagtagcagttatgttcgagcacatgcagtcttttaaacaaaaagcaaataatttggaaatatataaacatgaacaggagaataccatagccattttagaaaatgatctcaagtctcttgtctctgcttgtactgatgcgaccagagaactgcaatttgaagctaagaacaagttacttgaactccgctctgttcctgaacttgaggaattgagacataatttgccccaagaaacaggagcaactgatggagagaccacggaaacacatgagcaaggtattgatggcagcaactatagtaaaacagcaggaatgttgccagttgcttgcagaaatgttcaagctttggtcagacagtttgagatcacaagtaaagtggccgcgtctacaattgaagatttgcagaataaactgaaagaagctagaactacttctgaaaaagccattgaagaaagggatctaagacaaaataggatttccaagttggaggcggatatatatgcgttagaaagttcttgcactaatctgacgcttaaactagaggattatcaagcaaaagaggatagattgaaggaaagggaggcagaactttcatctctacacaatattttgtcaatgaaagaacaagagaatgaagactccctcctatcagcatcagaagtcaaaatcctctttgacaaaatcaaagggattgaaatccctataccagagtcagaagtaggagacttagaatcccataattcaactcatgtgaagaagctcttttgcgttattgataatattagtaactttcagcatcagataaactcactgtcttgcgaaaaagaagagctacaatcaacactccgaacgcagttgcttgaaatagagcatctaaaggaggaggtggaaaaccatgtcagagatggacaagatactgagaagatgaaaaatgaactgtctgtgctgatatatgctttgcaaaaaattatagatatgtcgggaggcgatgatttagttggagacgagaagtctgctggtgtgaagggacttgtgtcggtgttagagaagcaggttatggctttgctaattgaatctaaaaattcaaaatcaaaagctcaggaacttggcactaagttggtcgagagccaaaaggttgtggatgaattatcaaccaaggttaatttacttgaagtttcagctcaaggaagggttgctcagccagagattgtccaggaaaggagcatctttgaagcaccttccttgcctactggttcagagatatctgaaattgaagatgtgggatcacttggaagcaaaacgatatcccctgttccgtcagcagctcatgtgcgcatgatgcgaaagggttccactgaccatcttgcaattgatattgatcccgaatctactcgtttaatcagcactgaagaaactgacgaggacaaaggccatgtattcaagtctctcaatgcatctggtatcattccaagacaaggaaagttgattgcagatcgaattgatggaatttgggtatctggtggtcgaagtttgatgagtcgcccaagggctaggctaggcgtcattgcctactggcttgtcttgcatctgtggctgctaggagcatctcatcttgcatcggttgaaggattaccagtccttgactgctcattggaaatatcatttgattttgagatgtggcatcttcagttgattgccggattggttattttgatatcatcatcccgatatatattactgaagacatggccagaatttgcagagtctagcaaagcagccaatcaacaggtccttacttcacttcaacctttggatttcataatcgttgcatttttacctggggtcagcgaggaacttcttttccggggtgcgctgcagcctctttttggatccaatttgagtagtgcattggtggttgcccttgtctttggtgttctacacctgggcagtggccgaaagtattccttcgcagtctgggcaagtttggttgggtttctgtatggttacgcagccattgcatcttctagccttgttgtgccaatggtttctcatgcagtgaacaatttggtgggagggattttatggcgatacagttcagattcatcaggagagatatccgattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

2361

Amino Acids

263.64

Weight (kDa)

4.69

Isoelectric Point (pI)

48.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 4210, 4594
AatII GACGTC 1 cut(s) 72
Acc16I TGCGCA 1 cut(s) 6296
Acc36I ACCTGC 1 cut(s) 6004
AccBSI CCGCTC 3 cut(s) 2863, 3454, 5151
AccI GTMKAC 2 cut(s) 1408, 5348
AccII CGCG 3 cut(s) 122, 1461, 5345
AccIII TCCGGA 1 cut(s) 31
AclI AACGTT 2 cut(s) 187, 4248
AclWI GGATC 9 cut(s) 534, 3642, 4287, 4656, 5427, 6253, 6335, 6846, 6859
AcoI YGGCCR 5 cut(s) 22, 3036, 5340, 6710, 6913
AcyI GRCGYC 2 cut(s) 69, 6522
AdeI CACNNNGTG 1 cut(s) 4958
AfiI CCNNNNNNNGG 6 cut(s) 31, 329, 586, 779, 6437, 6848
AflIII ACRYGT 6 cut(s) 141, 691, 1769, 2027, 2270, 3669
AhdI GACNNNNNGTC 2 cut(s) 124, 5971
AhlI ACTAGT 2 cut(s) 209, 685
AjiI CACGTC 2 cut(s) 708, 2001
AjnI CCWGG 7 cut(s) 488, 3959, 4005, 4504, 6174, 6799, 6903
AjuI GAANNNNNNNTTGG 2 cut(s) 3281, 3313
AloI GAACNNNNNNTCC 4 cut(s) 128, 160, 6807, 6839
Alw21I GWGCWC 7 cut(s) 504, 849, 1153, 1799, 2057, 4545, 4986
AlwI GGATC 9 cut(s) 534, 3642, 4287, 4656, 5427, 6253, 6335, 6846, 6859
AlwNI CAGNNNCTG 2 cut(s) 2516, 3107
Aor13HI TCCGGA 1 cut(s) 31
AoxI GGCC 9 cut(s) 22, 486, 3036, 3333, 4242, 5340, 6391, 6710, 6913
Asp700I GAANNNNTTC 9 cut(s) 1293, 1491, 2610, 2853, 2872, 3201, 5392, 6310, 6922
AspLEI GCGC 2 cut(s) 6297, 6835
AspS9I GGNCC 4 cut(s) 2763, 3354, 4533, 6751
AsuC2I CCSGG 3 cut(s) 733, 781, 6827
AsuII TTCGAA 3 cut(s) 50, 147, 289
AvaII GGWCC 4 cut(s) 2763, 3354, 4533, 6751
BaeI ACNNNNGTAYC 4 cut(s) 1266, 1299, 3754, 3787
BalI TGGCCA 2 cut(s) 3038, 6712
BamHI GGATCC 1 cut(s) 6851
BanII GRGCYC 5 cut(s) 504, 849, 1799, 2057, 4545
BarI GAAGNNNNNNTAC 6 cut(s) 1305, 1337, 1440, 1472, 4155, 4187
BbsI GAAGAC 6 cut(s) 878, 2418, 3009, 4847, 5604, 6710
Bbv12I GWGCWC 7 cut(s) 504, 849, 1153, 1799, 2057, 4545, 4986
BbvCI CCTCAGC 2 cut(s) 3786, 4797
BceAI ACGGC 1 cut(s) 400
BcgI CGANNNNNNTGC 4 cut(s) 4013, 4047, 5957, 5991
BciT130I CCWGG 7 cut(s) 490, 3961, 4007, 4506, 6176, 6801, 6905
BciVI GTATCC 2 cut(s) 199, 3755
BclI TGATCA 3 cut(s) 313, 787, 4549
BcnI CCSGG 3 cut(s) 733, 781, 6827
BcuI ACTAGT 2 cut(s) 209, 685
BfmI CTRYAG 7 cut(s) 393, 2768, 3359, 4032, 4131, 5257, 6836
BfuAI ACCTGC 1 cut(s) 6004
BfuI GTATCC 2 cut(s) 199, 3755
BlpI GCTNAGC 3 cut(s) 4308, 4698, 6159
BmcAI AGTACT 1 cut(s) 4719
Bme18I GGWCC 4 cut(s) 2763, 3354, 4533, 6751
BmeRI GACNNNNNGTC 2 cut(s) 124, 5971
BmgBI CACGTC 2 cut(s) 708, 2001
BmgT120I GGNCC 4 cut(s) 2763, 3354, 4533, 6751
BmiI GGNNCC 6 cut(s) 2764, 2765, 3355, 3356, 6313, 6853
BoxI GACNNNNGTC 1 cut(s) 5995
BpiI GAAGAC 6 cut(s) 878, 2418, 3009, 4847, 5604, 6710
BplI GAGNNNNNCTC 6 cut(s) 1715, 1747, 1958, 1990, 2216, 2248
BpmI CTGGAG 4 cut(s) 1007, 1725, 3677, 4742
Bpu10I CCTNAGC 6 cut(s) 299, 632, 3506, 3786, 4797, 6060
Bpu1102I GCTNAGC 3 cut(s) 4308, 4698, 6159
Bpu14I TTCGAA 3 cut(s) 50, 147, 289
BpuEI CTTGAG 8 cut(s) 863, 1133, 1337, 1428, 3533, 5057, 5186, 6129
BpuMI CCSGG 3 cut(s) 733, 781, 6827
BsaAI YACGTR 3 cut(s) 1502, 2629, 3220
BsaBI GATNNNNATC 3 cut(s) 4647, 5657, 6339
BsaHI GRCGYC 2 cut(s) 69, 6522
BsaI GGTCTC 5 cut(s) 311, 548, 770, 4665, 5210
BsaWI WCCGGW 1 cut(s) 31
BsaXI ACNNNNNCTCC 6 cut(s) 128, 158, 458, 488, 5130, 5160
Bsc4I CCNNNNNNNGG 6 cut(s) 31, 329, 586, 779, 6437, 6848
Bse118I RCCGGY 1 cut(s) 79
Bse3DI GCAATG 5 cut(s) 1089, 1749, 2007, 6525, 6975
Bse8I GATNNNNATC 3 cut(s) 4647, 5657, 6339
BseAI TCCGGA 1 cut(s) 31
BseBI CCWGG 7 cut(s) 490, 3961, 4007, 4506, 6176, 6801, 6905
BseJI GATNNNNATC 3 cut(s) 4647, 5657, 6339
BseLI CCNNNNNNNGG 6 cut(s) 31, 329, 586, 779, 6437, 6848
BseMI GCAATG 5 cut(s) 1089, 1749, 2007, 6525, 6975
BseRI GAGGAG 4 cut(s) 2687, 3278, 4469, 5858
BsgI GTGCAG 2 cut(s) 1061, 4830
Bsh1236I CGCG 3 cut(s) 122, 1461, 5345
BshFI GGCC 9 cut(s) 24, 488, 3038, 3335, 4244, 5342, 6393, 6712, 6915
BsiHKAI GWGCWC 7 cut(s) 504, 849, 1153, 1799, 2057, 4545, 4986
BsiSI CCGG 7 cut(s) 21, 32, 80, 733, 780, 6660, 6826
BslFI GGGAC 4 cut(s) 2749, 3340, 3566, 6003
BslI CCNNNNNNNGG 6 cut(s) 31, 329, 586, 779, 6437, 6848
BsmBI CGTCTC 1 cut(s) 5958
BsmFI GGGAC 4 cut(s) 2749, 3340, 3566, 6003
BsmI GAATGC 9 cut(s) 58, 961, 1918, 2176, 2538, 2806, 3129, 3397, 3551
BsnI GGCC 9 cut(s) 24, 488, 3038, 3335, 4244, 5342, 6393, 6712, 6915
Bso31I GGTCTC 5 cut(s) 311, 548, 770, 4665, 5210
Bsp119I TTCGAA 3 cut(s) 50, 147, 289
Bsp1286I GDGCHC 7 cut(s) 504, 849, 1153, 1799, 2057, 4545, 4986
Bsp13I TCCGGA 1 cut(s) 31
Bsp1720I GCTNAGC 3 cut(s) 4308, 4698, 6159
Bsp19I CCATGG 1 cut(s) 3417
Bsp68I TCGCGA 1 cut(s) 1461
BspANI GGCC 9 cut(s) 24, 488, 3038, 3335, 4244, 5342, 6393, 6712, 6915
BspEI TCCGGA 1 cut(s) 31
BspFNI CGCG 3 cut(s) 122, 1461, 5345
BspHI TCATGA 1 cut(s) 3778
BspLI GGNNCC 6 cut(s) 2764, 2765, 3355, 3356, 6313, 6853
BspMAI CTGCAG 4 cut(s) 397, 4036, 4135, 6840
BspMI ACCTGC 1 cut(s) 6004
BspPI GGATC 9 cut(s) 534, 3642, 4287, 4656, 5427, 6253, 6335, 6846, 6859
BspQI GCTCTTC 3 cut(s) 5, 1284, 5784
BspT104I TTCGAA 3 cut(s) 50, 147, 289
BspTNI GGTCTC 5 cut(s) 311, 548, 770, 4665, 5210
BsrBI CCGCTC 3 cut(s) 2863, 3454, 5151
BsrDI GCAATG 5 cut(s) 1089, 1749, 2007, 6525, 6975
BsrFI RCCGGY 1 cut(s) 79
BssAI RCCGGY 1 cut(s) 79
BssNI GRCGYC 2 cut(s) 69, 6522
BssT1I CCWWGG 3 cut(s) 3417, 6117, 6506
Bst2UI CCWGG 7 cut(s) 490, 3961, 4007, 4506, 6176, 6801, 6905
BstACI GRCGYC 2 cut(s) 69, 6522
BstAPI GCANNNNNTGC 1 cut(s) 6977
BstBAI YACGTR 3 cut(s) 1502, 2629, 3220
BstBI TTCGAA 3 cut(s) 50, 147, 289
BstDSI CCRYGG 4 cut(s) 416, 2826, 3417, 5220
BstFNI CGCG 3 cut(s) 122, 1461, 5345
BstHHI GCGC 2 cut(s) 6297, 6835
BstNI CCWGG 7 cut(s) 490, 3961, 4007, 4506, 6176, 6801, 6905
BstNSI RCATGY 7 cut(s) 145, 695, 1773, 2031, 2274, 3673, 4990
BstPAI GACNNNNGTC 1 cut(s) 5995
BstSFI CTRYAG 7 cut(s) 393, 2768, 3359, 4032, 4131, 5257, 6836
BstSNI TACGTA 3 cut(s) 1502, 2629, 3220
BstUI CGCG 3 cut(s) 122, 1461, 5345
BstV2I GAAGAC 6 cut(s) 878, 2418, 3009, 4847, 5604, 6710
BstX2I RGATCY 4 cut(s) 4292, 4648, 5419, 6851
BstYI RGATCY 4 cut(s) 4292, 4648, 5419, 6851
BsuI GTATCC 2 cut(s) 199, 3755
BsuRI GGCC 9 cut(s) 24, 488, 3038, 3335, 4244, 5342, 6393, 6712, 6915
BtgI CCRYGG 4 cut(s) 416, 2826, 3417, 5220
BtgZI GCGATG 1 cut(s) 5964
BtrI CACGTC 2 cut(s) 708, 2001
BtuMI TCGCGA 1 cut(s) 1461
BveI ACCTGC 1 cut(s) 6004
CaiI CAGNNNCTG 2 cut(s) 2516, 3107
CciI TCATGA 1 cut(s) 3778
CfoI GCGC 2 cut(s) 6297, 6835
Cfr10I RCCGGY 1 cut(s) 79
Cfr13I GGNCC 4 cut(s) 2763, 3354, 4533, 6751
CseI GACGC 9 cut(s) 128, 1883, 2141, 2405, 2996, 3003, 5334, 5500, 6511
DraI TTTAAA 1 cut(s) 4999
DraIII CACNNNGTG 1 cut(s) 4958
DrdI GACNNNNNNGTC 2 cut(s) 4210, 4594
DriI GACNNNNNGTC 2 cut(s) 124, 5971
DseDI GACNNNNNNGTC 2 cut(s) 4210, 4594
EaeI YGGCCR 5 cut(s) 22, 3036, 5340, 6710, 6913
Eam1105I GACNNNNNGTC 2 cut(s) 124, 5971
EciI GGCGGA 2 cut(s) 3917, 5468
Ecl136II GAGCTC 5 cut(s) 502, 847, 1797, 2055, 4543
Eco105I TACGTA 3 cut(s) 1502, 2629, 3220
Eco130I CCWWGG 3 cut(s) 3417, 6117, 6506
Eco147I AGGCCT 1 cut(s) 3335
Eco24I GRGCYC 5 cut(s) 504, 849, 1799, 2057, 4545
Eco31I GGTCTC 5 cut(s) 311, 548, 770, 4665, 5210
Eco32I GATATC 5 cut(s) 166, 6225, 6267, 6678, 7077
Eco47I GGWCC 4 cut(s) 2763, 3354, 4533, 6751
Eco53kI GAGCTC 5 cut(s) 502, 847, 1797, 2055, 4543
EcoICRI GAGCTC 5 cut(s) 502, 847, 1797, 2055, 4543
EcoO109I RGGNCCY 4 cut(s) 2763, 3354, 4533, 6751
EcoRI GAATTC 2 cut(s) 291, 1370
EcoRII CCWGG 7 cut(s) 488, 3959, 4005, 4504, 6174, 6799, 6903
EcoRV GATATC 5 cut(s) 166, 6225, 6267, 6678, 7077
EcoT14I CCWWGG 3 cut(s) 3417, 6117, 6506
EcoT22I ATGCAT 5 cut(s) 595, 2540, 3131, 4489, 6418
EcoT38I GRGCYC 5 cut(s) 504, 849, 1799, 2057, 4545
ErhI CCWWGG 3 cut(s) 3417, 6117, 6506
Esp3I CGTCTC 1 cut(s) 5958
FaqI GGGAC 4 cut(s) 2749, 3340, 3566, 6003
FauI CCCGC 4 cut(s) 115, 1572, 2856, 3447
FauNDI CATATG 1 cut(s) 4735
FbaI TGATCA 3 cut(s) 313, 787, 4549
FblI GTMKAC 2 cut(s) 1408, 5348
FriOI GRGCYC 5 cut(s) 504, 849, 1799, 2057, 4545
FspAI RTGCGCAY 1 cut(s) 6296
FspI TGCGCA 1 cut(s) 6296
GlaI GCGC 2 cut(s) 6296, 6834
GsuI CTGGAG 4 cut(s) 1007, 1725, 3677, 4742
HaeIII GGCC 9 cut(s) 24, 488, 3038, 3335, 4244, 5342, 6393, 6712, 6915
HapII CCGG 7 cut(s) 21, 32, 80, 733, 780, 6660, 6826
HgaI GACGC 9 cut(s) 128, 1883, 2141, 2405, 2996, 3003, 5334, 5500, 6511
HhaI GCGC 2 cut(s) 6297, 6835
Hin1I GRCGYC 2 cut(s) 69, 6522
Hin6I GCGC 2 cut(s) 6295, 6833
HinP1I GCGC 2 cut(s) 6295, 6833
HincII GTYRAC 5 cut(s) 454, 650, 1554, 2319, 2910
HindII GTYRAC 5 cut(s) 454, 650, 1554, 2319, 2910
HindIII AAGCTT 3 cut(s) 1025, 4352, 5304
HpaI GTTAAC 3 cut(s) 454, 1554, 2910
HpaII CCGG 7 cut(s) 21, 32, 80, 733, 780, 6660, 6826
Hpy99I CGWCG 3 cut(s) 71, 74, 164
HpyCH4IV ACGT 9 cut(s) 69, 187, 707, 1501, 2000, 2258, 2628, 3219, 4248
HpySE526I ACGT 9 cut(s) 69, 187, 707, 1501, 2000, 2258, 2628, 3219, 4248
Hsp92I GRCGYC 2 cut(s) 69, 6522
HspAI GCGC 2 cut(s) 6295, 6833
KflI GGGWCCC 2 cut(s) 2763, 3354
Kpn2I TCCGGA 1 cut(s) 31
Ksp22I TGATCA 3 cut(s) 313, 787, 4549
KspAI GTTAAC 3 cut(s) 454, 1554, 2910
LguI GCTCTTC 3 cut(s) 5, 1284, 5784
LmnI GCTCC 9 cut(s) 982, 988, 1891, 2149, 2596, 3187, 5201, 6183, 6563
MaeII ACGT 9 cut(s) 69, 187, 707, 1501, 2000, 2258, 2628, 3219, 4248
MbiI CCGCTC 3 cut(s) 2863, 3454, 5151
MfeI CAATTG 3 cut(s) 3702, 5352, 6330
MflI RGATCY 4 cut(s) 4292, 4648, 5419, 6851
MhlI GDGCHC 7 cut(s) 504, 849, 1153, 1799, 2057, 4545, 4986
MlsI TGGCCA 2 cut(s) 3038, 6712
MluNI TGGCCA 2 cut(s) 3038, 6712
Mox20I TGGCCA 2 cut(s) 3038, 6712
Mph1103I ATGCAT 5 cut(s) 595, 2540, 3131, 4489, 6418
MroI TCCGGA 1 cut(s) 31
MroXI GAANNNNTTC 9 cut(s) 1293, 1491, 2610, 2853, 2872, 3201, 5392, 6310, 6922
MscI TGGCCA 2 cut(s) 3038, 6712
MslI CAYNNNNRTG 2 cut(s) 710, 734
Msp20I TGGCCA 2 cut(s) 3038, 6712
MspA1I CMGCKG 5 cut(s) 202, 1571, 1745, 2336, 2927
MspI CCGG 7 cut(s) 21, 32, 80, 733, 780, 6660, 6826
MunI CAATTG 3 cut(s) 3702, 5352, 6330
Mva1269I GAATGC 9 cut(s) 58, 961, 1918, 2176, 2538, 2806, 3129, 3397, 3551
MvaI CCWGG 7 cut(s) 490, 3961, 4007, 4506, 6176, 6801, 6905
MvnI CGCG 3 cut(s) 122, 1461, 5345
NciI CCSGG 3 cut(s) 733, 781, 6827
NcoI CCATGG 1 cut(s) 3417
NdeI CATATG 1 cut(s) 4735
NlaIV GGNNCC 6 cut(s) 2764, 2765, 3355, 3356, 6313, 6853
NmeAIII GCCGAG 1 cut(s) 118
NmuCI GTSAC 6 cut(s) 575, 3915, 4212, 4738, 4868, 4881
NruI TCGCGA 1 cut(s) 1461
NsbI TGCGCA 1 cut(s) 6296
NsiI ATGCAT 5 cut(s) 595, 2540, 3131, 4489, 6418
NspI RCATGY 7 cut(s) 145, 695, 1773, 2031, 2274, 3673, 4990
NspV TTCGAA 3 cut(s) 50, 147, 289
PagI TCATGA 1 cut(s) 3778
PceI AGGCCT 1 cut(s) 3335
PciI ACATGT 6 cut(s) 141, 691, 1769, 2027, 2270, 3669
PciSI GCTCTTC 3 cut(s) 5, 1284, 5784
PctI GAATGC 9 cut(s) 58, 961, 1918, 2176, 2538, 2806, 3129, 3397, 3551
PdmI GAANNNNTTC 9 cut(s) 1293, 1491, 2610, 2853, 2872, 3201, 5392, 6310, 6922
PflFI GACNNNGTC 1 cut(s) 882
PfoI TCCNGGA 1 cut(s) 6174
Ppu21I YACGTR 3 cut(s) 1502, 2629, 3220
PpuMI RGGWCCY 4 cut(s) 2763, 3354, 4533, 6751
PscI ACATGT 6 cut(s) 141, 691, 1769, 2027, 2270, 3669
PshAI GACNNNNGTC 1 cut(s) 5995
Psp124BI GAGCTC 5 cut(s) 504, 849, 1799, 2057, 4545
Psp1406I AACGTT 2 cut(s) 187, 4248
Psp5II RGGWCCY 4 cut(s) 2763, 3354, 4533, 6751
Psp6I CCWGG 7 cut(s) 488, 3959, 4005, 4504, 6174, 6799, 6903
PspGI CCWGG 7 cut(s) 488, 3959, 4005, 4504, 6174, 6799, 6903
PspN4I GGNNCC 6 cut(s) 2764, 2765, 3355, 3356, 6313, 6853
PspPI GGNCC 4 cut(s) 2763, 3354, 4533, 6751
PspPPI RGGWCCY 4 cut(s) 2763, 3354, 4533, 6751
PsrI GAACNNNNNNTAC 2 cut(s) 3636, 3668
PstI CTGCAG 4 cut(s) 397, 4036, 4135, 6840
PstNI CAGNNNCTG 2 cut(s) 2516, 3107
PsuI RGATCY 4 cut(s) 4292, 4648, 5419, 6851
PsyI GACNNNGTC 1 cut(s) 882
PvuII CAGCTG 4 cut(s) 202, 1571, 2336, 2927
RruI TCGCGA 1 cut(s) 1461
RseI CAYNNNNRTG 2 cut(s) 710, 734
SacI GAGCTC 5 cut(s) 504, 849, 1799, 2057, 4545
SapI GCTCTTC 3 cut(s) 5, 1284, 5784
Sau96I GGNCC 4 cut(s) 2763, 3354, 4533, 6751
ScaI AGTACT 1 cut(s) 4719
SduI GDGCHC 7 cut(s) 504, 849, 1153, 1799, 2057, 4545, 4986
SfcI CTRYAG 7 cut(s) 393, 2768, 3359, 4032, 4131, 5257, 6836
SfuI TTCGAA 3 cut(s) 50, 147, 289
SgrAI CRCCGGYG 1 cut(s) 79
SinI GGWCC 4 cut(s) 2763, 3354, 4533, 6751
SmiMI CAYNNNNRTG 2 cut(s) 710, 734
SmlI CTYRAG 8 cut(s) 842, 1112, 1352, 1443, 3512, 5072, 5165, 6144
SmoI CTYRAG 8 cut(s) 842, 1112, 1352, 1443, 3512, 5072, 5165, 6144
SnaBI TACGTA 3 cut(s) 1502, 2629, 3220
SpeI ACTAGT 2 cut(s) 209, 685
SseBI AGGCCT 1 cut(s) 3335
SspI AATATT 6 cut(s) 1543, 2662, 3253, 4771, 5569, 5743
SstI GAGCTC 5 cut(s) 504, 849, 1799, 2057, 4545
StuI AGGCCT 1 cut(s) 3335
StyI CCWWGG 3 cut(s) 3417, 6117, 6506
TaiI ACGT 9 cut(s) 72, 190, 710, 1504, 2003, 2261, 2631, 3222, 4251
TatI WGTACW 8 cut(s) 688, 1869, 2127, 2391, 2982, 3817, 4717, 5093
TauI GCSGC 1 cut(s) 5345
TseFI GTSAC 6 cut(s) 575, 3915, 4212, 4738, 4868, 4881
Tsp45I GTSAC 6 cut(s) 575, 3915, 4212, 4738, 4868, 4881
TspGWI ACGGA 4 cut(s) 1319, 2815, 5237, 6267
Tth111I GACNNNGTC 1 cut(s) 882
VpaK11BI GGWCC 4 cut(s) 2763, 3354, 4533, 6751
XbaI TCTAGA 3 cut(s) 889, 2665, 3256
XceI RCATGY 7 cut(s) 145, 695, 1773, 2031, 2274, 3673, 4990
XcmI CCANNNNNNNNNTGG 2 cut(s) 4381, 5864
XmiI GTMKAC 2 cut(s) 1408, 5348
XmnI GAANNNNTTC 9 cut(s) 1293, 1491, 2610, 2853, 2872, 3201, 5392, 6310, 6922
ZraI GACGTC 1 cut(s) 70
ZrmI AGTACT 1 cut(s) 4719
Zsp2I ATGCAT 5 cut(s) 595, 2540, 3131, 4489, 6418
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.