Rmu_co8251283.1_g000001

MORN repeat

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8251283.1
Physical Location & Seq
Forward (+)
1 .. 436
436 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8251283.1_g000001.1.cds

Sequence Viewer

Length: 268 bp
gtatgaaggtgaatggcttcaaaacaacatggagggtcatggggttgttgaagttgacatacctgacatagagcctattccaggttccaagcttgaagcacagatgcgtgctgaagggcacataatatcaagagattatatgaccccggaagacaaagaatggttggagatggatattcaagacagcattgatctagcaggggggcggtctgaaattcctttttatgaaaaagatgaatggatcagacattttgggaggaaaccgtaa

Protein Analysis

88

Amino Acids

10.27

Weight (kDa)

4.43

Isoelectric Point (pI)

45.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 206
AclWI GGATC 1 cut(s) 249
AcsI RAATTY 1 cut(s) 214
AcuI CTGAAG 1 cut(s) 133
AfiI CCNNNNNNNGG 1 cut(s) 81
AgsI TTSAA 4 cut(s) 21, 51, 96, 180
AjnI CCWGG 1 cut(s) 80
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
AlwI GGATC 1 cut(s) 249
ApoI RAATTY 1 cut(s) 214
Asp700I GAANNNNTTC 1 cut(s) 16
AsuC2I CCSGG 1 cut(s) 147
AsuHPI GGTGA 1 cut(s) 21
BaeGI GKGCMC 1 cut(s) 121
BarI GAAGNNNNNNTAC 2 cut(s) 43, 75
BbsI GAAGAC 1 cut(s) 157
BccI CCATC 1 cut(s) 164
BciT130I CCWGG 1 cut(s) 82
BcnI CCSGG 1 cut(s) 147
BfaI CTAG 1 cut(s) 195
Bme1390I CCNGG 2 cut(s) 82, 147
BmiI GGNNCC 1 cut(s) 86
BmrFI CCNGG 2 cut(s) 82, 147
BmsI GCATC 1 cut(s) 94
BpiI GAAGAC 1 cut(s) 157
BpuMI CCSGG 1 cut(s) 147
BsaJI CCNNGG 1 cut(s) 145
Bsc4I CCNNNNNNNGG 1 cut(s) 81
BseBI CCWGG 1 cut(s) 82
BseDI CCNNGG 1 cut(s) 145
BseLI CCNNNNNNNGG 1 cut(s) 81
BseSI GKGCMC 1 cut(s) 121
BsiSI CCGG 1 cut(s) 147
BslI CCNNNNNNNGG 1 cut(s) 81
Bsp1286I GDGCHC 1 cut(s) 121
Bsp143I GATC 2 cut(s) 191, 241
BspACI CCGC 1 cut(s) 206
BspLI GGNNCC 1 cut(s) 86
BspPI GGATC 1 cut(s) 249
BssECI CCNNGG 1 cut(s) 145
BssMI GATC 2 cut(s) 191, 241
Bst2UI CCWGG 1 cut(s) 82
Bst4CI ACNGT 1 cut(s) 265
BstC8I GCNNGC 1 cut(s) 109
BstENI CCTNNNNNAGG 1 cut(s) 79
BstKTI GATC 2 cut(s) 194, 244
BstMBI GATC 2 cut(s) 191, 241
BstNI CCWGG 1 cut(s) 82
BstSCI CCNGG 2 cut(s) 80, 145
BstSLI GKGCMC 1 cut(s) 121
BstV2I GAAGAC 1 cut(s) 157
Cac8I GCNNGC 1 cut(s) 109
CviAII CATG 2 cut(s) 29, 39
CviJI RGCY 3 cut(s) 17, 74, 92
CviKI_1 RGCY 3 cut(s) 17, 74, 92
DpnI GATC 2 cut(s) 193, 243
DpnII GATC 2 cut(s) 191, 241
Eco57I CTGAAG 1 cut(s) 133
EcoNI CCTNNNNNAGG 1 cut(s) 79
EcoRII CCWGG 1 cut(s) 80
FaeI CATG 2 cut(s) 32, 42
FaiI YATR 9 cut(s) 4, 30, 40, 60, 69, 123, 139, 141, 226
FatI CATG 2 cut(s) 28, 38
FspBI CTAG 1 cut(s) 195
HapII CCGG 1 cut(s) 147
Hin1II CATG 2 cut(s) 32, 42
HincII GTYRAC 1 cut(s) 56
HindII GTYRAC 1 cut(s) 56
HindIII AAGCTT 1 cut(s) 90
HpaII CCGG 1 cut(s) 147
HphI GGTGA 1 cut(s) 21
Hpy166II GTNNAC 1 cut(s) 56
Hpy188I TCNGA 2 cut(s) 212, 246
Hpy188III TCNNGA 2 cut(s) 130, 180
Hpy8I GTNNAC 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 108
HpyCH4III ACNGT 1 cut(s) 265
Hsp92II CATG 2 cut(s) 32, 42
Kzo9I GATC 2 cut(s) 191, 241
LpnPI CCDG 5 cut(s) 67, 76, 94, 160, 184
LweI GCATC 1 cut(s) 94
MaeI CTAG 1 cut(s) 195
MalI GATC 2 cut(s) 193, 243
MboI GATC 2 cut(s) 191, 241
MboII GAAGA 1 cut(s) 162
MhlI GDGCHC 1 cut(s) 121
MluCI AATT 1 cut(s) 214
MmeI TCCRAC 1 cut(s) 145
MnlI CCTC 2 cut(s) 26, 250
MroXI GAANNNNTTC 1 cut(s) 16
MspI CCGG 1 cut(s) 147
MspR9I CCNGG 2 cut(s) 82, 147
MvaI CCWGG 1 cut(s) 82
NciI CCSGG 1 cut(s) 147
NdeII GATC 2 cut(s) 191, 241
NlaIII CATG 2 cut(s) 32, 42
NlaIV GGNNCC 1 cut(s) 86
PdmI GAANNNNTTC 1 cut(s) 16
Psp6I CCWGG 1 cut(s) 80
PspGI CCWGG 1 cut(s) 80
PspN4I GGNNCC 1 cut(s) 86
Sau3AI GATC 2 cut(s) 191, 241
ScrFI CCNGG 2 cut(s) 82, 147
SduI GDGCHC 1 cut(s) 121
SetI ASST 4 cut(s) 11, 65, 86, 94
SfaNI GCATC 1 cut(s) 94
Sse9I AATT 1 cut(s) 214
SsiI CCGC 1 cut(s) 206
SspMI CTAG 1 cut(s) 195
StyD4I CCNGG 2 cut(s) 80, 145
TaaI ACNGT 1 cut(s) 265
TasI AATT 1 cut(s) 214
TspDTI ATGAA 3 cut(s) 19, 241, 250
XagI CCTNNNNNAGG 1 cut(s) 79
XapI RAATTY 1 cut(s) 214
XmnI GAANNNNTTC 1 cut(s) 16
XspI CTAG 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.