Rmu_co8261087.1_g000001

YT521-B-like domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8261087.1
OG0005296
Physical Location & Seq
Reverse (-)
2 .. 658
657 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8261087.1_g000001.1.cds

Sequence Viewer

Length: 449 bp
atgggttttctgcgaagttctaatggggccagtaacattgtaccctcagtcttgtattactctttcatatcaatgaaatttcaggtgaatctgaaacaaggaattgagctgttgaaaattttcaatgattatgatgcacggacatctatagttgatgattttgaattttatgatgaccgcgaaaggtccttgaaggaaaggaaagccagacaacaagcttgtgcaactacagatgcttctgagtcagttgctcttgatactgttaaggaatcttctaatatttccgatcaagccttggagatgaaaggaagtagtagcaaagaatttgcaggaactgaacaagacagtagctccaaaacagattcagttgtatatgaacatgatgctgtacagcaaatatctgatagtttatctcaagtattgcagttggaagagagtgacaaagaggt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
YTH

Protein Analysis

150

Amino Acids

16.78

Weight (kDa)

4.49

Isoelectric Point (pI)

56.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 180
AciI CCGC 1 cut(s) 178
AcsI RAATTY 4 cut(s) 77, 117, 164, 323
AfaI GTAC 2 cut(s) 42, 390
AgsI TTSAA 4 cut(s) 115, 124, 164, 193
AluBI AGCT 3 cut(s) 109, 218, 351
AluI AGCT 3 cut(s) 109, 218, 351
AlwNI CAGNNNCTG 1 cut(s) 335
AoxI GGCC 1 cut(s) 27
ApoI RAATTY 4 cut(s) 77, 117, 164, 323
Asp700I GAANNNNTTC 1 cut(s) 119
AspS9I GGNCC 2 cut(s) 27, 186
AsuHPI GGTGA 1 cut(s) 97
AvaII GGWCC 1 cut(s) 186
BfmI CTRYAG 2 cut(s) 147, 228
Bme18I GGWCC 1 cut(s) 186
BmgT120I GGNCC 2 cut(s) 27, 186
BmiI GGNNCC 1 cut(s) 28
BmsI GCATC 3 cut(s) 124, 223, 373
BpuEI CTTGAG 1 cut(s) 399
BsaJI CCNNGG 1 cut(s) 294
BsaXI ACNNNNNCTCC 2 cut(s) 335, 365
Bse1I ACTGG 1 cut(s) 30
BseDI CCNNGG 1 cut(s) 294
BseMII CTCAG 2 cut(s) 60, 231
BseNI ACTGG 1 cut(s) 30
Bsh1236I CGCG 1 cut(s) 180
BshFI GGCC 1 cut(s) 29
BsnI GGCC 1 cut(s) 29
Bsp1407I TGTACA 1 cut(s) 388
Bsp143I GATC 1 cut(s) 286
BspACI CCGC 1 cut(s) 178
BspANI GGCC 1 cut(s) 29
BspCNI CTCAG 2 cut(s) 59, 232
BspFNI CGCG 1 cut(s) 180
BspLI GGNNCC 1 cut(s) 28
BsrGI TGTACA 1 cut(s) 388
BsrI ACTGG 1 cut(s) 30
BssECI CCNNGG 1 cut(s) 294
BssMI GATC 1 cut(s) 286
BssT1I CCWWGG 1 cut(s) 294
Bst4CI ACNGT 2 cut(s) 262, 347
Bst6I CTCTTC 1 cut(s) 426
BstAUI TGTACA 1 cut(s) 388
BstDEI CTNAG 2 cut(s) 46, 240
BstFNI CGCG 1 cut(s) 180
BstKTI GATC 1 cut(s) 289
BstMBI GATC 1 cut(s) 286
BstSFI CTRYAG 2 cut(s) 147, 228
BstUI CGCG 1 cut(s) 180
BsuRI GGCC 1 cut(s) 29
CaiI CAGNNNCTG 1 cut(s) 335
Cfr13I GGNCC 2 cut(s) 27, 186
Csp6I GTAC 2 cut(s) 41, 389
CviAII CATG 1 cut(s) 380
CviJI RGCY 6 cut(s) 29, 109, 206, 218, 293, 351
CviKI_1 RGCY 6 cut(s) 29, 109, 206, 218, 293, 351
CviQI GTAC 2 cut(s) 41, 389
DdeI CTNAG 2 cut(s) 46, 240
DpnI GATC 1 cut(s) 288
DpnII GATC 1 cut(s) 286
Eam1104I CTCTTC 1 cut(s) 426
EarI CTCTTC 1 cut(s) 426
Eco130I CCWWGG 1 cut(s) 294
Eco47I GGWCC 1 cut(s) 186
EcoO109I RGGNCCY 1 cut(s) 186
EcoT14I CCWWGG 1 cut(s) 294
ErhI CCWWGG 1 cut(s) 294
FaeI CATG 1 cut(s) 383
FaiI YATR 7 cut(s) 68, 132, 149, 171, 373, 375, 381
FatI CATG 1 cut(s) 379
HaeIII GGCC 1 cut(s) 29
Hin1II CATG 1 cut(s) 383
HindIII AAGCTT 1 cut(s) 216
HinfI GANTC 4 cut(s) 88, 242, 269, 362
HphI GGTGA 1 cut(s) 97
Hpy188I TCNGA 4 cut(s) 93, 241, 286, 403
Hpy188III TCNNGA 1 cut(s) 254
HpyAV CCTTC 1 cut(s) 187
HpyCH4III ACNGT 2 cut(s) 262, 347
HpyCH4V TGCA 4 cut(s) 137, 224, 329, 424
HpyF3I CTNAG 2 cut(s) 46, 240
Hsp92II CATG 1 cut(s) 383
Kzo9I GATC 1 cut(s) 286
LmnI GCTCC 1 cut(s) 356
LpnPI CCDG 4 cut(s) 43, 68, 220, 315
LweI GCATC 3 cut(s) 124, 223, 373
MaeIII GTNAC 2 cut(s) 32, 437
MalI GATC 1 cut(s) 288
MboI GATC 1 cut(s) 286
MboII GAAGA 2 cut(s) 264, 443
MluCI AATT 5 cut(s) 77, 102, 117, 164, 323
MlyI GAGTC 1 cut(s) 251
MmeI TCCRAC 1 cut(s) 408
MnlI CCTC 2 cut(s) 55, 439
MroXI GAANNNNTTC 1 cut(s) 119
MseI TTAA 1 cut(s) 264
MslI CAYNNNNRTG 1 cut(s) 71
MvnI CGCG 1 cut(s) 180
NdeII GATC 1 cut(s) 286
NlaIII CATG 1 cut(s) 383
NlaIV GGNNCC 1 cut(s) 28
NmuCI GTSAC 1 cut(s) 437
PdmI GAANNNNTTC 1 cut(s) 119
PfeI GAWTC 3 cut(s) 88, 269, 362
PleI GAGTC 1 cut(s) 250
PpsI GAGTC 1 cut(s) 250
PpuMI RGGWCCY 1 cut(s) 186
Psp5II RGGWCCY 1 cut(s) 186
PspN4I GGNNCC 1 cut(s) 28
PspPI GGNCC 2 cut(s) 27, 186
PspPPI RGGWCCY 1 cut(s) 186
PstNI CAGNNNCTG 1 cut(s) 335
RsaI GTAC 2 cut(s) 42, 390
RsaNI GTAC 2 cut(s) 41, 389
RseI CAYNNNNRTG 1 cut(s) 71
SaqAI TTAA 1 cut(s) 264
Sau3AI GATC 1 cut(s) 286
Sau96I GGNCC 2 cut(s) 27, 186
SchI GAGTC 1 cut(s) 251
SetI ASST 5 cut(s) 87, 111, 188, 220, 353
SfaNI GCATC 3 cut(s) 124, 223, 373
SfcI CTRYAG 2 cut(s) 147, 228
SinI GGWCC 1 cut(s) 186
SmiMI CAYNNNNRTG 1 cut(s) 71
SmlI CTYRAG 1 cut(s) 414
SmoI CTYRAG 1 cut(s) 414
Sse9I AATT 5 cut(s) 77, 102, 117, 164, 323
SsiI CCGC 1 cut(s) 178
SspI AATATT 1 cut(s) 280
StyI CCWWGG 1 cut(s) 294
TaaI ACNGT 2 cut(s) 262, 347
TasI AATT 5 cut(s) 77, 102, 117, 164, 323
TatI WGTACW 1 cut(s) 388
TfiI GAWTC 3 cut(s) 88, 269, 362
Tru1I TTAA 1 cut(s) 264
Tru9I TTAA 1 cut(s) 264
TseFI GTSAC 1 cut(s) 437
Tsp45I GTSAC 1 cut(s) 437
TspDTI ATGAA 4 cut(s) 55, 89, 317, 390
TspGWI ACGGA 1 cut(s) 154
VpaK11BI GGWCC 1 cut(s) 186
XapI RAATTY 4 cut(s) 77, 117, 164, 323
XmnI GAANNNNTTC 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.