Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8274905.1

Orthogroup ID

OG0006389

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 836

Gene Structure 836 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8274905.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 756 bp

tgaatgatgaactaatgaaagctagattgagcattcgagagcttgaagctaagcggaggtctttcaggaagagagtcagacactttttgaggaaacttgaagaggaaagagtgttgcagaagcgcagagaacgccagagagatcgtgcggttattaaggagttgatgaaagaactaagcagggaaaggaggagtcgtcaacggatggaaaatcttagcaccaatctggtcagtcggttagccaatgcaaagttgtctgcagaccagttcatgaaaacgtatgaggaagagaaacaaaacagaagattcatggaacaagtttgtagcgaactagctgaacacattggagagaacaaggcaggattgaaggcattgaaaagagaatccatgaaaattattgatgaactggaagaagagagaaagatgttgcagatgactgaggcttggcgtgaagaacgagtgcagatgaagctgattgatgctaaactggctcttgaagataaatatcatcaggtgaacaagctgataacagatgttgaaactttcttaaggtcaagattcactaccctggatatgccggaattaagaaaggctgagttgatcctacaggaagttaagtcgttgaatattcaagatatcgaggaatttacatatattgctctgaaatcagatgatatattctctacttttgaagagttccgaccatatgaaggtaaagggagagagattaaaccttgcatttgtcacagtgcttcta

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

251

Amino Acids

30.23

Weight (kDa)

9.23

Isoelectric Point (pI)

65.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006389)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g02210
malus_domestica	MD05G1345300.v1.1
prunus_persica	Prupe.4G021500_v2.0.a1
pyrus_communis	pycom05g31420
rosa_chinensis	RchiOBHm_Chr5g0003281
rosa_laevigata	RLG00000018061 RLG00000031103 RLG00000031104 RLG00000031121
rosa_multiflora	Rmu_co8274905.1_g000001 Rmu_sc0002494.1_g000002 Rmu_sc0002494.1_g000004 Rmu_sc0010917.1_g000009 Rmu_sc0010917.1_g000010
rosa_roxburghii	Rroxscaffold_1G00072680
rosa_rugosa	Rorug04G0401900 Rorug04G0402400
rosa_samantha	Rh5AG028400 Rh5AG028500 Rh5BG028600 Rh5CG030800 Rh5CG030900 Rh5DG027600 Rh5DG029000 Rh5DG029100
rosa_wichuraiana	Rw5G002650 Rw5G002700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	54, 148
AclWI	GGATC	1 cut(s)	594
AcsI	RAATTY	1 cut(s)	643
AfiI	CCNNNNNNNGG	1 cut(s)	709
AflII	CTTAAG	1 cut(s)	546
AgsI	TTSAA	9 cut(s)	46, 100, 366, 375, 496, 538, 624, 631, 691
AjnI	CCWGG	1 cut(s)	566
AluBI	AGCT	6 cut(s)	22, 42, 49, 334, 471, 522
AluI	AGCT	6 cut(s)	22, 42, 49, 334, 471, 522
AlwI	GGATC	1 cut(s)	594
ApoI	RAATTY	1 cut(s)	643
AspLEI	GCGC	1 cut(s)	125
AsuHPI	GGTGA	1 cut(s)	525
BccI	CCATC	1 cut(s)	198
BciT130I	CCWGG	1 cut(s)	568
BfaI	CTAG	2 cut(s)	23, 331
BfmI	CTRYAG	2 cut(s)	257, 604
BfrI	CTTAAG	1 cut(s)	546
BlpI	GCTNAGC	1 cut(s)	50
Bme1390I	CCNGG	1 cut(s)	568
BmrFI	CCNGG	1 cut(s)	568
BmsI	GCATC	1 cut(s)	468
Bpu1102I	GCTNAGC	1 cut(s)	50
BsaBI	GATNNNNATC	1 cut(s)	503
BsaJI	CCNNGG	1 cut(s)	566
BsaXI	ACNNNNNCTCC	2 cut(s)	180, 210
Bsc4I	CCNNNNNNNGG	1 cut(s)	709
Bse1I	ACTGG	3 cut(s)	264, 410, 491
Bse8I	GATNNNNATC	1 cut(s)	503
BseBI	CCWGG	1 cut(s)	568
BseDI	CCNNGG	1 cut(s)	566
BseGI	GGATG	1 cut(s)	209
BseJI	GATNNNNATC	1 cut(s)	503
BseLI	CCNNNNNNNGG	1 cut(s)	709
BseMII	CTCAG	2 cut(s)	428, 584
BseNI	ACTGG	3 cut(s)	264, 410, 491
BseRI	GAGGAG	1 cut(s)	204
BsgI	GTGCAG	1 cut(s)	481
BsiSI	CCGG	1 cut(s)	577
BslI	CCNNNNNNNGG	1 cut(s)	709
BsmI	GAATGC	1 cut(s)	32
Bsp143I	GATC	2 cut(s)	141, 599
Bsp1720I	GCTNAGC	1 cut(s)	50
BspACI	CCGC	2 cut(s)	54, 148
BspCNI	CTCAG	2 cut(s)	429, 585
BspHI	TCATGA	1 cut(s)	269
BspMAI	CTGCAG	1 cut(s)	261
BspPI	GGATC	1 cut(s)	594
BspTI	CTTAAG	1 cut(s)	546
BsrI	ACTGG	3 cut(s)	264, 410, 491
BssECI	CCNNGG	1 cut(s)	566
BssMI	GATC	2 cut(s)	141, 599
Bst2UI	CCWGG	1 cut(s)	568
Bst4CI	ACNGT	1 cut(s)	748
Bst6I	CTCTTC	5 cut(s)	64, 95, 281, 407, 686
BstAFI	CTTAAG	1 cut(s)	546
BstDEI	CTNAG	5 cut(s)	50, 175, 214, 437, 593
BstF5I	GGATG	1 cut(s)	209
BstHHI	GCGC	1 cut(s)	125
BstKTI	GATC	2 cut(s)	144, 602
BstMBI	GATC	2 cut(s)	141, 599
BstMWI	GCNNNNNNNGC	3 cut(s)	131, 468, 487
BstNI	CCWGG	1 cut(s)	568
BstSCI	CCNGG	1 cut(s)	566
BstSFI	CTRYAG	2 cut(s)	257, 604
BtsCI	GGATG	1 cut(s)	209
BtsIMutI	CAGTG	1 cut(s)	753
CciI	TCATGA	1 cut(s)	269
CfoI	GCGC	1 cut(s)	125
CviAII	CATG	3 cut(s)	270, 309, 387
DdeI	CTNAG	5 cut(s)	50, 175, 214, 437, 593
DpnI	GATC	2 cut(s)	143, 601
DpnII	GATC	2 cut(s)	141, 599
Eam1104I	CTCTTC	5 cut(s)	64, 95, 281, 407, 686
EarI	CTCTTC	5 cut(s)	64, 95, 281, 407, 686
Eco32I	GATATC	1 cut(s)	636
EcoRII	CCWGG	1 cut(s)	566
EcoRV	GATATC	1 cut(s)	636
FaeI	CATG	3 cut(s)	273, 312, 390
FatI	CATG	3 cut(s)	269, 308, 386
FauNDI	CATATG	1 cut(s)	705
FokI	GGATG	1 cut(s)	216
FspBI	CTAG	2 cut(s)	23, 331
GlaI	GCGC	1 cut(s)	124
HapII	CCGG	1 cut(s)	577
HhaI	GCGC	1 cut(s)	125
Hin1II	CATG	3 cut(s)	273, 312, 390
Hin6I	GCGC	1 cut(s)	123
HinP1I	GCGC	1 cut(s)	123
HincII	GTYRAC	1 cut(s)	199
HindII	GTYRAC	1 cut(s)	199
HinfI	GANTC	5 cut(s)	74, 192, 305, 382, 557
HpaII	CCGG	1 cut(s)	577
HphI	GGTGA	1 cut(s)	525
Hpy166II	GTNNAC	2 cut(s)	199, 516
Hpy188I	TCNGA	4 cut(s)	79, 662, 669, 700
Hpy188III	TCNNGA	6 cut(s)	37, 66, 270, 493, 554, 631
Hpy8I	GTNNAC	2 cut(s)	199, 516
HpyAV	CCTTC	2 cut(s)	360, 703
HpyCH4III	ACNGT	1 cut(s)	748
HpyCH4IV	ACGT	1 cut(s)	277
HpyCH4V	TGCA	6 cut(s)	117, 247, 259, 429, 462, 737
HpyF10VI	GCNNNNNNNGC	3 cut(s)	131, 468, 487
HpyF3I	CTNAG	5 cut(s)	50, 175, 214, 437, 593
HpySE526I	ACGT	1 cut(s)	277
Hsp92II	CATG	3 cut(s)	273, 312, 390
HspAI	GCGC	1 cut(s)	123
Kzo9I	GATC	2 cut(s)	141, 599
LweI	GCATC	1 cut(s)	468
MaeI	CTAG	2 cut(s)	23, 331
MaeII	ACGT	1 cut(s)	277
MaeIII	GTNAC	1 cut(s)	742
MalI	GATC	2 cut(s)	143, 601
MboI	GATC	2 cut(s)	141, 599
MboII	GAAGA	9 cut(s)	81, 112, 298, 314, 421, 424, 463, 508, 703
MluCI	AATT	3 cut(s)	392, 580, 643
MlyI	GAGTC	2 cut(s)	83, 201
MmeI	TCCRAC	1 cut(s)	723
MnlI	CCTC	7 cut(s)	50, 83, 96, 182, 276, 432, 633
MseI	TTAA	5 cut(s)	155, 547, 583, 614, 728
MspCI	CTTAAG	1 cut(s)	546
MspI	CCGG	1 cut(s)	577
MspR9I	CCNGG	1 cut(s)	568
Mva1269I	GAATGC	1 cut(s)	32
MvaI	CCWGG	1 cut(s)	568
MwoI	GCNNNNNNNGC	3 cut(s)	131, 468, 487
NdeI	CATATG	1 cut(s)	705
NdeII	GATC	2 cut(s)	141, 599
NlaIII	CATG	3 cut(s)	273, 312, 390
NmuCI	GTSAC	1 cut(s)	742
PagI	TCATGA	1 cut(s)	269
PctI	GAATGC	1 cut(s)	32
PfeI	GAWTC	3 cut(s)	305, 382, 557
PleI	GAGTC	2 cut(s)	82, 200
PpsI	GAGTC	2 cut(s)	82, 200
Psp6I	CCWGG	1 cut(s)	566
PspGI	CCWGG	1 cut(s)	566
PstI	CTGCAG	1 cut(s)	261
SaqAI	TTAA	5 cut(s)	155, 547, 583, 614, 728
Sau3AI	GATC	2 cut(s)	141, 599
SchI	GAGTC	2 cut(s)	83, 201
ScrFI	CCNGG	1 cut(s)	568
SfaNI	GCATC	1 cut(s)	468
SfcI	CTRYAG	2 cut(s)	257, 604
SmlI	CTYRAG	1 cut(s)	546
SmoI	CTYRAG	1 cut(s)	546
Sse9I	AATT	3 cut(s)	392, 580, 643
SsiI	CCGC	2 cut(s)	54, 148
SspI	AATATT	1 cut(s)	627
SspMI	CTAG	2 cut(s)	23, 331
StyD4I	CCNGG	1 cut(s)	566
TaaI	ACNGT	1 cut(s)	748
TaiI	ACGT	1 cut(s)	280
TaqI	TCGA	2 cut(s)	36, 638
TasI	AATT	3 cut(s)	392, 580, 643
TfiI	GAWTC	3 cut(s)	305, 382, 557
Tru1I	TTAA	5 cut(s)	155, 547, 583, 614, 728
Tru9I	TTAA	5 cut(s)	155, 547, 583, 614, 728
TscAI	CASTG	1 cut(s)	753
TseFI	GTSAC	1 cut(s)	742
Tsp45I	GTSAC	1 cut(s)	742
TspGWI	ACGGA	1 cut(s)	216
TspRI	CASTG	1 cut(s)	753
Vha464I	CTTAAG	1 cut(s)	546
XapI	RAATTY	1 cut(s)	643
XspI	CTAG	2 cut(s)	23, 331

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.