Rmu_sc0010917.1_g000009

BEST Arabidopsis thaliana protein match is

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010917.1
OG0006389
Physical Location & Seq
Forward (+)
54889 .. 55428
540 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010917.1_g000009.1.cds

Sequence Viewer

Length: 540 bp
atgcttgaaaaacatttccaatgcttcgcgagttcttgtcattcattgggagggcatagttcctccattctcagggttggccgatgccgacatgtgtctaggagcggaagtgcatgtaatgataatgcaggtcaatcctctccagatactgaaatcattgaagtttgcccagtatcggagcagcaatcagagcagaagctgtcttctatgtccaagctttggagatcatgcccaactaatggtgaagtttttaagataattttggatgaagacaagagcaggctctcaaatggggttacatcatgtttgcaaagaaatgctgatagtagactgactgaacatgagaccagacaccgggattcaaatgaacatttgttcccaccggacatagcgaatccacacatctctcgagggatgaaaggacgcattgaatggccccgagccatccaaaagaaaggttcaaatgccaagcttttggaagcaaaaatagaaagccagagatctcaactgcgccatgtttttaaacagaggtttaggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

179

Amino Acids

20.25

Weight (kDa)

9.37

Isoelectric Point (pI)

76.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 119
AccB7I CCANNNNNTGG 2 cut(s) 219, 239
AccBSI CCGCTC 1 cut(s) 105
AccI GTMKAC 1 cut(s) 328
AccII CGCG 1 cut(s) 29
AciI CCGC 1 cut(s) 105
AcoI YGGCCR 1 cut(s) 79
AfiI CCNNNNNNNGG 5 cut(s) 72, 175, 219, 239, 354
AflIII ACRYGT 1 cut(s) 91
AgsI TTSAA 5 cut(s) 8, 161, 363, 431, 462
AloI GAACNNNNNNTCC 2 cut(s) 360, 392
AluBI AGCT 3 cut(s) 199, 217, 472
AluI AGCT 3 cut(s) 199, 217, 472
Alw26I GTCTC 1 cut(s) 338
AlwNI CAGNNNCTG 2 cut(s) 149, 199
Ama87I CYCGRG 2 cut(s) 408, 438
AoxI GGCC 2 cut(s) 79, 434
ApeKI GCWGC 1 cut(s) 181
AspLEI GCGC 1 cut(s) 513
AspS9I GGNCC 1 cut(s) 435
AsuC2I CCSGG 1 cut(s) 356
AsuHPI GGTGA 1 cut(s) 254
AvaI CYCGRG 2 cut(s) 408, 438
BbsI GAAGAC 2 cut(s) 195, 276
BbvI GCAGC 1 cut(s) 193
BccI CCATC 1 cut(s) 452
BcnI CCSGG 1 cut(s) 356
BcoDI GTCTC 1 cut(s) 338
BfaI CTAG 1 cut(s) 99
BfuAI ACCTGC 1 cut(s) 119
BglII AGATCT 1 cut(s) 500
BisI GCNGC 1 cut(s) 182
BlsI GCNGC 1 cut(s) 183
Bme1390I CCNGG 1 cut(s) 356
BmeT110I CYCGRG 2 cut(s) 408, 438
BmgT120I GGNCC 1 cut(s) 435
BmiI GGNNCC 1 cut(s) 437
BmrFI CCNGG 1 cut(s) 356
BmrI ACTGGG 1 cut(s) 164
BmsI GCATC 1 cut(s) 74
BmuI ACTGGG 1 cut(s) 164
BoxI GACNNNNGTC 1 cut(s) 94
BpiI GAAGAC 2 cut(s) 195, 276
BpmI CTGGAG 1 cut(s) 126
BpuMI CCSGG 1 cut(s) 356
BsaI GGTCTC 1 cut(s) 338
BsaWI WCCGGW 1 cut(s) 382
BsaXI ACNNNNNCTCC 2 cut(s) 94, 124
Bsc4I CCNNNNNNNGG 5 cut(s) 72, 175, 219, 239, 354
Bse1I ACTGG 1 cut(s) 170
BseGI GGATG 3 cut(s) 271, 420, 444
BseLI CCNNNNNNNGG 5 cut(s) 72, 175, 219, 239, 354
BseMII CTCAG 1 cut(s) 85
BseNI ACTGG 1 cut(s) 170
BseXI GCAGC 1 cut(s) 193
Bsh1236I CGCG 1 cut(s) 29
BshFI GGCC 2 cut(s) 81, 436
BsiHKCI CYCGRG 2 cut(s) 408, 438
BsiSI CCGG 2 cut(s) 355, 383
BslI CCNNNNNNNGG 5 cut(s) 72, 175, 219, 239, 354
BsmAI GTCTC 1 cut(s) 338
BsnI GGCC 2 cut(s) 81, 436
Bso31I GGTCTC 1 cut(s) 338
BsoBI CYCGRG 2 cut(s) 408, 438
Bsp143I GATC 2 cut(s) 224, 500
Bsp68I TCGCGA 1 cut(s) 29
BspACI CCGC 1 cut(s) 105
BspANI GGCC 2 cut(s) 81, 436
BspCNI CTCAG 1 cut(s) 84
BspFNI CGCG 1 cut(s) 29
BspLI GGNNCC 1 cut(s) 437
BspMI ACCTGC 1 cut(s) 119
BspTNI GGTCTC 1 cut(s) 338
BsrBI CCGCTC 1 cut(s) 105
BsrI ACTGG 1 cut(s) 170
BssMI GATC 2 cut(s) 224, 500
BstC8I GCNNGC 1 cut(s) 281
BstDEI CTNAG 1 cut(s) 71
BstF5I GGATG 3 cut(s) 271, 420, 444
BstFNI CGCG 1 cut(s) 29
BstHHI GCGC 1 cut(s) 513
BstKTI GATC 2 cut(s) 227, 503
BstMAI GTCTC 1 cut(s) 338
BstMBI GATC 2 cut(s) 224, 500
BstMWI GCNNNNNNNGC 1 cut(s) 190
BstNSI RCATGY 2 cut(s) 95, 117
BstPAI GACNNNNGTC 1 cut(s) 94
BstSCI CCNGG 1 cut(s) 354
BstUI CGCG 1 cut(s) 29
BstV1I GCAGC 1 cut(s) 193
BstV2I GAAGAC 2 cut(s) 195, 276
BstX2I RGATCY 1 cut(s) 500
BstXI CCANNNNNNTGG 1 cut(s) 475
BstYI RGATCY 1 cut(s) 500
BsuRI GGCC 2 cut(s) 81, 436
BtsCI GGATG 3 cut(s) 271, 420, 444
BtuMI TCGCGA 1 cut(s) 29
BveI ACCTGC 1 cut(s) 119
Cac8I GCNNGC 1 cut(s) 281
CaiI CAGNNNCTG 2 cut(s) 149, 199
CfoI GCGC 1 cut(s) 513
Cfr13I GGNCC 1 cut(s) 435
CseI GACGC 1 cut(s) 432
CviAII CATG 6 cut(s) 92, 114, 228, 303, 341, 515
CviJI RGCY 8 cut(s) 81, 199, 217, 283, 436, 443, 472, 495
CviKI_1 RGCY 8 cut(s) 81, 199, 217, 283, 436, 443, 472, 495
DdeI CTNAG 1 cut(s) 71
DpnI GATC 2 cut(s) 226, 502
DpnII GATC 2 cut(s) 224, 500
DraI TTTAAA 1 cut(s) 523
EaeI YGGCCR 1 cut(s) 79
Eco31I GGTCTC 1 cut(s) 338
Eco88I CYCGRG 2 cut(s) 408, 438
FaeI CATG 6 cut(s) 95, 117, 231, 306, 344, 518
FaiI YATR 9 cut(s) 57, 93, 115, 209, 229, 304, 342, 389, 516
FatI CATG 6 cut(s) 91, 113, 227, 302, 340, 514
FblI GTMKAC 1 cut(s) 328
Fnu4HI GCNGC 1 cut(s) 182
FokI GGATG 3 cut(s) 278, 427, 431
Fsp4HI GCNGC 1 cut(s) 182
FspBI CTAG 1 cut(s) 99
GlaI GCGC 1 cut(s) 512
GluI GCNGC 1 cut(s) 182
GsuI CTGGAG 1 cut(s) 126
HaeIII GGCC 2 cut(s) 81, 436
HapII CCGG 2 cut(s) 355, 383
HgaI GACGC 1 cut(s) 432
HhaI GCGC 1 cut(s) 513
Hin1II CATG 6 cut(s) 95, 117, 231, 306, 344, 518
Hin6I GCGC 1 cut(s) 511
HinP1I GCGC 1 cut(s) 511
HindIII AAGCTT 2 cut(s) 215, 470
HinfI GANTC 2 cut(s) 359, 394
HpaII CCGG 2 cut(s) 355, 383
HphI GGTGA 1 cut(s) 254
Hpy166II GTNNAC 1 cut(s) 329
Hpy188I TCNGA 2 cut(s) 178, 190
Hpy188III TCNNGA 3 cut(s) 28, 143, 408
Hpy8I GTNNAC 1 cut(s) 329
HpyCH4V TGCA 3 cut(s) 113, 128, 310
HpyF10VI GCNNNNNNNGC 1 cut(s) 190
HpyF3I CTNAG 1 cut(s) 71
Hsp92II CATG 6 cut(s) 95, 117, 231, 306, 344, 518
HspAI GCGC 1 cut(s) 511
Kzo9I GATC 2 cut(s) 224, 500
LmnI GCTCC 2 cut(s) 102, 178
LpnPI CCDG 9 cut(s) 58, 114, 156, 183, 265, 361, 368, 396, 509
Lsp1109I GCAGC 1 cut(s) 193
LweI GCATC 1 cut(s) 74
MaeI CTAG 1 cut(s) 99
MaeIII GTNAC 1 cut(s) 295
MalI GATC 2 cut(s) 226, 502
MbiI CCGCTC 1 cut(s) 105
MboI GATC 2 cut(s) 224, 500
MboII GAAGA 2 cut(s) 195, 281
MflI RGATCY 1 cut(s) 500
MluCI AATT 1 cut(s) 258
MnlI CCTC 5 cut(s) 44, 73, 148, 404, 522
MseI TTAA 2 cut(s) 252, 522
MspI CCGG 2 cut(s) 355, 383
MspR9I CCNGG 1 cut(s) 356
MvnI CGCG 1 cut(s) 29
MwoI GCNNNNNNNGC 1 cut(s) 190
NciI CCSGG 1 cut(s) 356
NdeII GATC 2 cut(s) 224, 500
NlaIII CATG 6 cut(s) 95, 117, 231, 306, 344, 518
NlaIV GGNNCC 1 cut(s) 437
NruI TCGCGA 1 cut(s) 29
NspI RCATGY 2 cut(s) 95, 117
PaeR7I CTCGAG 1 cut(s) 408
PciI ACATGT 1 cut(s) 91
PfeI GAWTC 2 cut(s) 359, 394
PflMI CCANNNNNTGG 2 cut(s) 219, 239
PkrI GCNGC 1 cut(s) 183
PscI ACATGT 1 cut(s) 91
PshAI GACNNNNGTC 1 cut(s) 94
PspN4I GGNNCC 1 cut(s) 437
PspPI GGNCC 1 cut(s) 435
PstNI CAGNNNCTG 2 cut(s) 149, 199
PsuI RGATCY 1 cut(s) 500
RruI TCGCGA 1 cut(s) 29
SaqAI TTAA 2 cut(s) 252, 522
SatI GCNGC 1 cut(s) 182
Sau3AI GATC 2 cut(s) 224, 500
Sau96I GGNCC 1 cut(s) 435
ScrFI CCNGG 1 cut(s) 356
SetI ASST 7 cut(s) 133, 201, 219, 460, 474, 533, 539
SfaNI GCATC 1 cut(s) 74
Sfr274I CTCGAG 1 cut(s) 408
SlaI CTCGAG 1 cut(s) 408
SmlI CTYRAG 1 cut(s) 408
SmoI CTYRAG 1 cut(s) 408
Sse9I AATT 1 cut(s) 258
SsiI CCGC 1 cut(s) 105
SspMI CTAG 1 cut(s) 99
StyD4I CCNGG 1 cut(s) 354
TaqI TCGA 1 cut(s) 409
TasI AATT 1 cut(s) 258
TfiI GAWTC 2 cut(s) 359, 394
Tru1I TTAA 2 cut(s) 252, 522
Tru9I TTAA 2 cut(s) 252, 522
TseI GCWGC 1 cut(s) 181
TspDTI ATGAA 4 cut(s) 33, 282, 381, 431
Van91I CCANNNNNTGG 2 cut(s) 219, 239
XceI RCATGY 2 cut(s) 95, 117
XhoI CTCGAG 1 cut(s) 408
XmiI GTMKAC 1 cut(s) 328
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.