Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8321223.1

Orthogroup ID

OG0013779

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 654

Gene Structure 653 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8321223.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 653 bp

atgctctcaaaacaagcttggcgtgtagctttacatccgatttctttgatagctcaattatacaaagcacgttactttccgaatgtgaatttttggactgcaactgaacatgcaactccttctttctcttggcatagtatctttgctactcgggatttacttaaggagggagcattatggaagattggtaatggtgctagtgtgtcaatttggaatgactcttggatccctacactgccttcgcataaaccacaagctactgttgttttgcaacatgatgtggaactagttggtgaattgattgtacctcctaacttgtggaatgagcaaaaagtgcgcaactcttttgtcaatcatgaggctgaggctattctttcattccctcttagcactagaggtcctgaagacaggctttcatggcatctagaaagaagaggtatgtttaggttaaaatcttcctattgttttgcattttcaaaattagcttctactcttcctccttctgtggtaacaaaccaaagagtgtggaaaaagatctggcaagctaagatgaccaattcggcaaaagtgaatgcttggaaaattgggcagaatattcttccaacactggaccgacttgttgctaggcatgttcctgtggaatctcaggtttg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 RVT_3 zf-RVT

Protein Analysis

217

Amino Acids

24.81

Weight (kDa)

10.0

Isoelectric Point (pI)

35.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013779)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000036421
rosa_multiflora	Rmu_co8321223.1_g000001 Rmu_sc0000441.1_g000003 Rmu_sc0000470.1_g000009 Rmu_sc0001694.1_g000026 Rmu_sc0006059.1_g000038 Rmu_sc0010720.1_g000005 Rmu_sc0011178.1_g000002 Rmu_sc0012409.1_g000004 Rmu_sc0012535.1_g000007 Rmu_ssc0000467.1_g000043
rosa_rugosa	Rorug02G0074200 Rorug05G0089300 Rorug05G0370300
rosa_samantha	Rh1DG240000 Rh4DG427300 Rh6CG287000 Rh6DG280000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	338
AclWI	GGATC	2 cut(s)	220, 233
AcsI	RAATTY	1 cut(s)	88
AcuI	CTGAAG	1 cut(s)	423
AfaI	GTAC	1 cut(s)	306
AflII	CTTAAG	1 cut(s)	161
AgsI	TTSAA	1 cut(s)	477
AhlI	ACTAGT	1 cut(s)	286
AluBI	AGCT	6 cut(s)	17, 29, 53, 257, 485, 545
AluI	AGCT	6 cut(s)	17, 29, 53, 257, 485, 545
AlwI	GGATC	2 cut(s)	220, 233
Ama87I	CYCGRG	1 cut(s)	150
ApoI	RAATTY	1 cut(s)	88
AspLEI	GCGC	1 cut(s)	339
AspS9I	GGNCC	2 cut(s)	398, 610
AsuHPI	GGTGA	1 cut(s)	305
AvaI	CYCGRG	1 cut(s)	150
AvaII	GGWCC	2 cut(s)	398, 610
BamHI	GGATCC	1 cut(s)	225
BbsI	GAAGAC	1 cut(s)	411
BbvCI	CCTCAGC	1 cut(s)	363
BcuI	ACTAGT	1 cut(s)	286
BfaI	CTAG	5 cut(s)	198, 287, 393, 425, 624
BfrI	CTTAAG	1 cut(s)	161
BglII	AGATCT	1 cut(s)	534
Bme18I	GGWCC	2 cut(s)	398, 610
BmeT110I	CYCGRG	1 cut(s)	150
BmgT120I	GGNCC	2 cut(s)	398, 610
BmiI	GGNNCC	1 cut(s)	227
BmsI	GCATC	1 cut(s)	430
BpiI	GAAGAC	1 cut(s)	411
Bpu10I	CCTNAGC	1 cut(s)	363
BsaXI	ACNNNNNCTCC	2 cut(s)	481, 511
Bse1I	ACTGG	1 cut(s)	612
BseGI	GGATG	1 cut(s)	34
BseMII	CTCAG	1 cut(s)	354
BseNI	ACTGG	1 cut(s)	612
BsiHKCI	CYCGRG	1 cut(s)	150
BsmI	GAATGC	1 cut(s)	577
BsoBI	CYCGRG	1 cut(s)	150
Bsp143I	GATC	2 cut(s)	225, 534
BspCNI	CTCAG	1 cut(s)	355
BspHI	TCATGA	1 cut(s)	355
BspLI	GGNNCC	1 cut(s)	227
BspPI	GGATC	2 cut(s)	220, 233
BspTI	CTTAAG	1 cut(s)	161
BsrI	ACTGG	1 cut(s)	612
BssMI	GATC	2 cut(s)	225, 534
Bst4CI	ACNGT	1 cut(s)	262
Bst6I	CTCTTC	2 cut(s)	427, 498
BstAFI	CTTAAG	1 cut(s)	161
BstAPI	GCANNNNNTGC	1 cut(s)	334
BstC8I	GCNNGC	1 cut(s)	543
BstDEI	CTNAG	4 cut(s)	363, 386, 546, 645
BstF5I	GGATG	1 cut(s)	34
BstHHI	GCGC	1 cut(s)	339
BstKTI	GATC	2 cut(s)	228, 537
BstMBI	GATC	2 cut(s)	225, 534
BstMWI	GCNNNNNNNGC	2 cut(s)	334, 418
BstNSI	RCATGY	2 cut(s)	113, 632
BstV2I	GAAGAC	1 cut(s)	411
BstX2I	RGATCY	2 cut(s)	225, 534
BstYI	RGATCY	2 cut(s)	225, 534
BtsCI	GGATG	1 cut(s)	34
BtsI	GCAGTG	1 cut(s)	233
BtsIMutI	CAGTG	2 cut(s)	233, 605
Cac8I	GCNNGC	1 cut(s)	543
CciI	TCATGA	1 cut(s)	355
CfoI	GCGC	1 cut(s)	339
Cfr13I	GGNCC	2 cut(s)	398, 610
Csp6I	GTAC	1 cut(s)	305
CspCI	CAANNNNNGTGG	2 cut(s)	506, 541
CviAII	CATG	5 cut(s)	110, 275, 356, 417, 629
CviJI	RGCY	9 cut(s)	17, 29, 53, 257, 362, 368, 412, 485, 545
CviKI_1	RGCY	9 cut(s)	17, 29, 53, 257, 362, 368, 412, 485, 545
CviQI	GTAC	1 cut(s)	305
DdeI	CTNAG	4 cut(s)	363, 386, 546, 645
DpnI	GATC	2 cut(s)	227, 536
DpnII	GATC	2 cut(s)	225, 534
Eam1104I	CTCTTC	2 cut(s)	427, 498
EarI	CTCTTC	2 cut(s)	427, 498
Eco47I	GGWCC	2 cut(s)	398, 610
Eco57I	CTGAAG	1 cut(s)	423
Eco88I	CYCGRG	1 cut(s)	150
EcoO109I	RGGNCCY	1 cut(s)	398
FaeI	CATG	5 cut(s)	113, 278, 359, 420, 632
FalI	AAGNNNNNCTT	2 cut(s)	396, 428
FatI	CATG	5 cut(s)	109, 274, 355, 416, 628
FokI	GGATG	1 cut(s)	21
FspBI	CTAG	5 cut(s)	198, 287, 393, 425, 624
FspI	TGCGCA	1 cut(s)	338
GlaI	GCGC	1 cut(s)	338
HhaI	GCGC	1 cut(s)	339
Hin1II	CATG	5 cut(s)	113, 278, 359, 420, 632
Hin6I	GCGC	1 cut(s)	337
HinP1I	GCGC	1 cut(s)	337
HindIII	AAGCTT	1 cut(s)	15
HinfI	GANTC	2 cut(s)	218, 641
HphI	GGTGA	1 cut(s)	305
Hpy188I	TCNGA	2 cut(s)	39, 81
Hpy188III	TCNNGA	4 cut(s)	152, 356, 401, 425
HpyAV	CCTTC	3 cut(s)	129, 249, 510
HpyCH4III	ACNGT	1 cut(s)	262
HpyCH4IV	ACGT	1 cut(s)	70
HpyCH4V	TGCA	4 cut(s)	101, 113, 271, 470
HpyF10VI	GCNNNNNNNGC	2 cut(s)	334, 418
HpyF3I	CTNAG	4 cut(s)	363, 386, 546, 645
HpySE526I	ACGT	1 cut(s)	70
Hsp92II	CATG	5 cut(s)	113, 278, 359, 420, 632
HspAI	GCGC	1 cut(s)	337
Kzo9I	GATC	2 cut(s)	225, 534
LmnI	GCTCC	1 cut(s)	170
LpnPI	CCDG	6 cut(s)	394, 414, 523, 593, 632, 648
LweI	GCATC	1 cut(s)	430
MaeI	CTAG	5 cut(s)	198, 287, 393, 425, 624
MaeII	ACGT	1 cut(s)	70
MaeIII	GTNAC	2 cut(s)	71, 508
MalI	GATC	2 cut(s)	227, 536
MboI	GATC	2 cut(s)	225, 534
MboII	GAAGA	6 cut(s)	193, 416, 444, 447, 485, 590
MflI	RGATCY	2 cut(s)	225, 534
MluCI	AATT	7 cut(s)	56, 88, 207, 296, 479, 556, 582
MlyI	GAGTC	1 cut(s)	212
MmeI	TCCRAC	1 cut(s)	626
MnlI	CCTC	8 cut(s)	160, 318, 352, 358, 389, 393, 428, 507
MseI	TTAA	2 cut(s)	162, 449
MspCI	CTTAAG	1 cut(s)	161
Mva1269I	GAATGC	1 cut(s)	577
MwoI	GCNNNNNNNGC	2 cut(s)	334, 418
NdeII	GATC	2 cut(s)	225, 534
NlaIII	CATG	5 cut(s)	113, 278, 359, 420, 632
NlaIV	GGNNCC	1 cut(s)	227
NsbI	TGCGCA	1 cut(s)	338
NspI	RCATGY	2 cut(s)	113, 632
PagI	TCATGA	1 cut(s)	355
PctI	GAATGC	1 cut(s)	577
PfeI	GAWTC	1 cut(s)	641
PleI	GAGTC	1 cut(s)	212
PpsI	GAGTC	1 cut(s)	212
PpuMI	RGGWCCY	1 cut(s)	398
Psp5II	RGGWCCY	1 cut(s)	398
PspN4I	GGNNCC	1 cut(s)	227
PspPI	GGNCC	2 cut(s)	398, 610
PspPPI	RGGWCCY	1 cut(s)	398
PsuI	RGATCY	2 cut(s)	225, 534
RsaI	GTAC	1 cut(s)	306
RsaNI	GTAC	1 cut(s)	305
SaqAI	TTAA	2 cut(s)	162, 449
Sau3AI	GATC	2 cut(s)	225, 534
Sau96I	GGNCC	2 cut(s)	398, 610
SchI	GAGTC	1 cut(s)	212
SfaNI	GCATC	1 cut(s)	430
SinI	GGWCC	2 cut(s)	398, 610
SmlI	CTYRAG	1 cut(s)	161
SmoI	CTYRAG	1 cut(s)	161
SpeI	ACTAGT	1 cut(s)	286
Sse9I	AATT	7 cut(s)	56, 88, 207, 296, 479, 556, 582
SspI	AATATT	1 cut(s)	595
SspMI	CTAG	5 cut(s)	198, 287, 393, 425, 624
TaaI	ACNGT	1 cut(s)	262
TaiI	ACGT	1 cut(s)	73
TaqII	GACCGA	1 cut(s)	627
TasI	AATT	7 cut(s)	56, 88, 207, 296, 479, 556, 582
TfiI	GAWTC	1 cut(s)	641
Tru1I	TTAA	2 cut(s)	162, 449
Tru9I	TTAA	2 cut(s)	162, 449
TscAI	CASTG	2 cut(s)	240, 612
TspDTI	ATGAA	2 cut(s)	366, 405
TspRI	CASTG	2 cut(s)	240, 612
Vha464I	CTTAAG	1 cut(s)	161
VpaK11BI	GGWCC	2 cut(s)	398, 610
XapI	RAATTY	1 cut(s)	88
XbaI	TCTAGA	1 cut(s)	424
XceI	RCATGY	2 cut(s)	113, 632
XspI	CTAG	5 cut(s)	198, 287, 393, 425, 624

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.