Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000441.1

Orthogroup ID

OG0013779

Physical Location & Seq

Genomic Coordinates Forward (+)

7387 .. 7698

Gene Structure 312 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000441.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 312 bp

atgctagccaaacaagcatggcgtgtgatcaataatcctcaatcgctgaaagttcgactctttaaagctaagtattatccagaaggttccttttggacaacttcgtcccatgcttctccttattcttggaggagtatcttttccacaagtgatttgataaggaaaggcacttattggcagataggtgatggggcattggtgaacatatggagggattcgtggattcctggggtgccagattgtaagcctagagaaggtaatttggctatgaatgaagtcaatatggtgagtgatttgatatgtcactactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_3 zf-RVT

Protein Analysis

103

Amino Acids

11.9

Weight (kDa)

9.26

Isoelectric Point (pI)

36.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013779)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000036421
rosa_multiflora	Rmu_co8321223.1_g000001 Rmu_sc0000441.1_g000003 Rmu_sc0000470.1_g000009 Rmu_sc0001694.1_g000026 Rmu_sc0006059.1_g000038 Rmu_sc0010720.1_g000005 Rmu_sc0011178.1_g000002 Rmu_sc0012409.1_g000004 Rmu_sc0012535.1_g000007 Rmu_ssc0000467.1_g000043
rosa_rugosa	Rorug02G0074200 Rorug05G0089300 Rorug05G0370300
rosa_samantha	Rh1DG240000 Rh4DG427300 Rh6CG287000 Rh6DG280000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	103
AccB1I	GGYRCC	1 cut(s)	232
AfiI	CCNNNNNNNGG	1 cut(s)	254
AjnI	CCWGG	1 cut(s)	226
AluBI	AGCT	1 cut(s)	68
AluI	AGCT	1 cut(s)	68
AsuHPI	GGTGA	3 cut(s)	197, 211, 298
AsuNHI	GCTAGC	1 cut(s)	4
BanI	GGYRCC	1 cut(s)	232
BccI	CCATC	1 cut(s)	182
BciT130I	CCWGG	1 cut(s)	228
BclI	TGATCA	1 cut(s)	27
BfaI	CTAG	3 cut(s)	5, 249, 310
Bme1390I	CCNGG	1 cut(s)	228
BmiI	GGNNCC	2 cut(s)	88, 234
BmrFI	CCNGG	1 cut(s)	228
BmtI	GCTAGC	1 cut(s)	8
BsaJI	CCNNGG	1 cut(s)	227
Bsc4I	CCNNNNNNNGG	1 cut(s)	254
BseBI	CCWGG	1 cut(s)	228
BseDI	CCNNGG	1 cut(s)	227
BseLI	CCNNNNNNNGG	1 cut(s)	254
BseRI	GAGGAG	1 cut(s)	145
BshNI	GGYRCC	1 cut(s)	232
BslFI	GGGAC	1 cut(s)	91
BslI	CCNNNNNNNGG	1 cut(s)	254
BsmFI	GGGAC	1 cut(s)	91
Bsp143I	GATC	1 cut(s)	27
BspLI	GGNNCC	2 cut(s)	88, 234
BspOI	GCTAGC	1 cut(s)	8
BspT107I	GGYRCC	1 cut(s)	232
BssECI	CCNNGG	1 cut(s)	227
BssMI	GATC	1 cut(s)	27
Bst2UI	CCWGG	1 cut(s)	228
BstC8I	GCNNGC	1 cut(s)	6
BstDEI	CTNAG	1 cut(s)	69
BstENI	CCTNNNNNAGG	1 cut(s)	252
BstKTI	GATC	1 cut(s)	30
BstMBI	GATC	1 cut(s)	27
BstMWI	GCNNNNNNNGC	1 cut(s)	14
BstNI	CCWGG	1 cut(s)	228
BstSCI	CCNGG	1 cut(s)	226
Cac8I	GCNNGC	1 cut(s)	6
CviAII	CATG	2 cut(s)	18, 110
CviJI	RGCY	4 cut(s)	8, 68, 247, 266
CviKI_1	RGCY	4 cut(s)	8, 68, 247, 266
DdeI	CTNAG	1 cut(s)	69
DpnI	GATC	1 cut(s)	29
DpnII	GATC	1 cut(s)	27
DraI	TTTAAA	1 cut(s)	64
DrdI	GACNNNNNNGTC	1 cut(s)	103
DseDI	GACNNNNNNGTC	1 cut(s)	103
EcoNI	CCTNNNNNAGG	1 cut(s)	252
EcoRII	CCWGG	1 cut(s)	226
FaeI	CATG	2 cut(s)	21, 113
FaiI	YATR	7 cut(s)	19, 111, 206, 208, 269, 284, 301
FaqI	GGGAC	1 cut(s)	91
FatI	CATG	2 cut(s)	17, 109
FauNDI	CATATG	1 cut(s)	206
FbaI	TGATCA	1 cut(s)	27
FspBI	CTAG	3 cut(s)	5, 249, 310
Hin1II	CATG	2 cut(s)	21, 113
HinfI	GANTC	3 cut(s)	57, 215, 223
HphI	GGTGA	3 cut(s)	197, 211, 298
Hpy166II	GTNNAC	1 cut(s)	202
Hpy188III	TCNNGA	1 cut(s)	80
Hpy8I	GTNNAC	1 cut(s)	202
HpyAV	CCTTC	2 cut(s)	77, 248
HpyF10VI	GCNNNNNNNGC	1 cut(s)	14
HpyF3I	CTNAG	1 cut(s)	69
Hsp92II	CATG	2 cut(s)	21, 113
Ksp22I	TGATCA	1 cut(s)	27
Kzo9I	GATC	1 cut(s)	27
LpnPI	CCDG	4 cut(s)	93, 213, 240, 249
MaeI	CTAG	3 cut(s)	5, 249, 310
MaeIII	GTNAC	1 cut(s)	302
MalI	GATC	1 cut(s)	29
MboI	GATC	1 cut(s)	27
MluCI	AATT	1 cut(s)	259
MlyI	GAGTC	1 cut(s)	51
MnlI	CCTC	3 cut(s)	48, 123, 204
MseI	TTAA	1 cut(s)	63
MspR9I	CCNGG	1 cut(s)	228
MvaI	CCWGG	1 cut(s)	228
MwoI	GCNNNNNNNGC	1 cut(s)	14
NdeI	CATATG	1 cut(s)	206
NdeII	GATC	1 cut(s)	27
NheI	GCTAGC	1 cut(s)	4
NlaIII	CATG	2 cut(s)	21, 113
NlaIV	GGNNCC	2 cut(s)	88, 234
NmuCI	GTSAC	1 cut(s)	302
PfeI	GAWTC	2 cut(s)	215, 223
PleI	GAGTC	1 cut(s)	51
PpsI	GAGTC	1 cut(s)	51
Psp6I	CCWGG	1 cut(s)	226
PspGI	CCWGG	1 cut(s)	226
PspN4I	GGNNCC	2 cut(s)	88, 234
SaqAI	TTAA	1 cut(s)	63
Sau3AI	GATC	1 cut(s)	27
SchI	GAGTC	1 cut(s)	51
ScrFI	CCNGG	1 cut(s)	228
SetI	ASST	4 cut(s)	70, 88, 187, 259
Sse9I	AATT	1 cut(s)	259
SspMI	CTAG	3 cut(s)	5, 249, 310
StyD4I	CCNGG	1 cut(s)	226
TaqI	TCGA	1 cut(s)	55
TasI	AATT	1 cut(s)	259
TfiI	GAWTC	2 cut(s)	215, 223
Tru1I	TTAA	1 cut(s)	63
Tru9I	TTAA	1 cut(s)	63
TseFI	GTSAC	1 cut(s)	302
Tsp45I	GTSAC	1 cut(s)	302
TspDTI	ATGAA	2 cut(s)	284, 288
XagI	CCTNNNNNAGG	1 cut(s)	252
XspI	CTAG	3 cut(s)	5, 249, 310

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.