Rmu_sc0012409.1_g000004

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012409.1
OG0013779
Physical Location & Seq
Forward (+)
2812 .. 3231
420 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012409.1_g000004.1.cds

Sequence Viewer

Length: 420 bp
atgttagcaaaacaggcatggaggattattaatcatcccaattccctaattgcatggatttatgccgcacggtatttcccttcgagttcgttttggactgcggggatgtatgcatctccttcttactcttggagaagtatattgtctacaatggaattaattgctgatggtctatattggcaaattggtaatggtgagagggtgaaagcttggtgtgatccttggataccgagacttccatcttttaaaccagaactgcaagttaacagtggggacattacactcaaggttagtgatctttttcttacagagcattcttgggatgaaaggaaaattcggaatatattttccgccaatacagcagaggctatcttatgtattcctctaagctctagaagtgctgaggacaggtgtgcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

139

Amino Acids

15.92

Weight (kDa)

7.72

Isoelectric Point (pI)

40.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 146
AciI CCGC 3 cut(s) 66, 101, 351
AclWI GGATC 1 cut(s) 212
AcsI RAATTY 1 cut(s) 333
AluBI AGCT 2 cut(s) 209, 390
AluI AGCT 2 cut(s) 209, 390
Alw26I GTCTC 1 cut(s) 226
AlwI GGATC 1 cut(s) 212
ApoI RAATTY 1 cut(s) 333
AseI ATTAAT 2 cut(s) 30, 158
AsuHPI GGTGA 2 cut(s) 206, 214
BbvCI CCTCAGC 1 cut(s) 402
BccI CCATC 2 cut(s) 161, 247
BciVI GTATCC 1 cut(s) 219
BcoDI GTCTC 1 cut(s) 226
BfaI CTAG 1 cut(s) 393
BfuI GTATCC 1 cut(s) 219
BisI GCNGC 1 cut(s) 66
BlsI GCNGC 1 cut(s) 67
BmsI GCATC 1 cut(s) 122
Bpu10I CCTNAGC 1 cut(s) 402
BpuEI CTTGAG 1 cut(s) 269
BsaJI CCNNGG 1 cut(s) 221
BseDI CCNNGG 1 cut(s) 221
BseGI GGATG 3 cut(s) 34, 111, 328
BseMII CTCAG 1 cut(s) 393
BslFI GGGAC 1 cut(s) 287
BsmAI GTCTC 1 cut(s) 226
BsmFI GGGAC 1 cut(s) 287
BsmI GAATGC 1 cut(s) 313
Bsp143I GATC 2 cut(s) 217, 295
BspACI CCGC 3 cut(s) 66, 101, 351
BspCNI CTCAG 1 cut(s) 394
BspPI GGATC 1 cut(s) 212
BssECI CCNNGG 1 cut(s) 221
BssMI GATC 2 cut(s) 217, 295
BssT1I CCWWGG 1 cut(s) 221
Bst4CI ACNGT 2 cut(s) 72, 269
BstDEI CTNAG 3 cut(s) 386, 402, 417
BstF5I GGATG 3 cut(s) 34, 111, 328
BstKTI GATC 2 cut(s) 220, 298
BstMAI GTCTC 1 cut(s) 226
BstMBI GATC 2 cut(s) 217, 295
BstMWI GCNNNNNNNGC 2 cut(s) 14, 359
BsuI GTATCC 1 cut(s) 219
BtsCI GGATG 3 cut(s) 34, 111, 328
BtsIMutI CAGTG 1 cut(s) 274
CviAII CATG 2 cut(s) 18, 54
CviJI RGCY 3 cut(s) 209, 368, 390
CviKI_1 RGCY 3 cut(s) 209, 368, 390
DdeI CTNAG 3 cut(s) 386, 402, 417
DpnI GATC 2 cut(s) 219, 297
DpnII GATC 2 cut(s) 217, 295
DraI TTTAAA 1 cut(s) 247
EciI GGCGGA 1 cut(s) 340
Eco130I CCWWGG 1 cut(s) 221
EcoT14I CCWWGG 1 cut(s) 221
EcoT22I ATGCAT 1 cut(s) 115
ErhI CCWWGG 1 cut(s) 221
FaeI CATG 2 cut(s) 21, 57
FaiI YATR 8 cut(s) 19, 55, 63, 111, 140, 175, 344, 376
FaqI GGGAC 1 cut(s) 287
FatI CATG 2 cut(s) 17, 53
FauI CCCGC 1 cut(s) 94
FblI GTMKAC 1 cut(s) 146
Fnu4HI GCNGC 1 cut(s) 66
FokI GGATG 3 cut(s) 21, 118, 335
Fsp4HI GCNGC 1 cut(s) 66
FspBI CTAG 1 cut(s) 393
GluI GCNGC 1 cut(s) 66
Hin1II CATG 2 cut(s) 21, 57
HincII GTYRAC 1 cut(s) 265
HindII GTYRAC 1 cut(s) 265
HindIII AAGCTT 1 cut(s) 207
HpaI GTTAAC 1 cut(s) 265
HphI GGTGA 2 cut(s) 206, 214
Hpy166II GTNNAC 2 cut(s) 147, 265
Hpy188I TCNGA 1 cut(s) 339
Hpy188III TCNNGA 1 cut(s) 393
Hpy8I GTNNAC 2 cut(s) 147, 265
HpyAV CCTTC 2 cut(s) 90, 129
HpyCH4III ACNGT 2 cut(s) 72, 269
HpyCH4V TGCA 3 cut(s) 53, 113, 259
HpyF10VI GCNNNNNNNGC 2 cut(s) 14, 359
HpyF3I CTNAG 3 cut(s) 386, 402, 417
Hsp92II CATG 2 cut(s) 21, 57
KspAI GTTAAC 1 cut(s) 265
Kzo9I GATC 2 cut(s) 217, 295
LpnPI CCDG 2 cut(s) 264, 394
LweI GCATC 1 cut(s) 122
MaeI CTAG 1 cut(s) 393
MalI GATC 2 cut(s) 219, 297
MboI GATC 2 cut(s) 217, 295
MluCI AATT 6 cut(s) 40, 48, 155, 159, 183, 333
MnlI CCTC 5 cut(s) 15, 192, 358, 393, 397
Mph1103I ATGCAT 1 cut(s) 115
MseI TTAA 4 cut(s) 30, 158, 246, 264
Mva1269I GAATGC 1 cut(s) 313
MwoI GCNNNNNNNGC 2 cut(s) 14, 359
NdeII GATC 2 cut(s) 217, 295
NlaIII CATG 2 cut(s) 21, 57
NsiI ATGCAT 1 cut(s) 115
PctI GAATGC 1 cut(s) 313
PkrI GCNGC 1 cut(s) 67
PshBI ATTAAT 2 cut(s) 30, 158
SaqAI TTAA 4 cut(s) 30, 158, 246, 264
SatI GCNGC 1 cut(s) 66
Sau3AI GATC 2 cut(s) 217, 295
SetI ASST 4 cut(s) 211, 291, 392, 413
SfaNI GCATC 1 cut(s) 122
SmlI CTYRAG 1 cut(s) 284
SmoI CTYRAG 1 cut(s) 284
Sse9I AATT 6 cut(s) 40, 48, 155, 159, 183, 333
SsiI CCGC 3 cut(s) 66, 101, 351
SspMI CTAG 1 cut(s) 393
StyI CCWWGG 1 cut(s) 221
TaaI ACNGT 2 cut(s) 72, 269
TaqI TCGA 1 cut(s) 83
TasI AATT 6 cut(s) 40, 48, 155, 159, 183, 333
TauI GCSGC 1 cut(s) 68
Tru1I TTAA 4 cut(s) 30, 158, 246, 264
Tru9I TTAA 4 cut(s) 30, 158, 246, 264
TscAI CASTG 1 cut(s) 274
TspDTI ATGAA 1 cut(s) 339
TspRI CASTG 1 cut(s) 274
VspI ATTAAT 2 cut(s) 30, 158
XapI RAATTY 1 cut(s) 333
XbaI TCTAGA 1 cut(s) 392
XmiI GTMKAC 1 cut(s) 146
XspI CTAG 1 cut(s) 393
Zsp2I ATGCAT 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.