Rmu_co8321565.1_g000001

protein At5g50100, mitochondrial-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8321565.1
Physical Location & Seq
Reverse (-)
1 .. 748
748 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8321565.1_g000001.1.cds

Sequence Viewer

Length: 294 bp
atgagagctataagtgaagcggctgtgaatcccgtaactcccaagaaaggagatgaacgagaatcagcacctgagaattggaagattaagatgctgtatgatggggattgtccactatgtatgagagaggtgaatatgctgagagagagaaacaagagttatggtactatcaagtttgttgacataagctcagaggattactctccgggggataatatggggctagactacaaaactgttatgggaaacattcatgccatcctctctgatggaaccgtagttactgatgtcgaa

Protein Analysis

98

Amino Acids

10.96

Weight (kDa)

4.83

Isoelectric Point (pI)

41.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 20
AfaI GTAC 1 cut(s) 166
AfiI CCNNNNNNNGG 1 cut(s) 47
AluBI AGCT 2 cut(s) 8, 189
AluI AGCT 2 cut(s) 8, 189
AlwNI CAGNNNCTG 1 cut(s) 71
AsuC2I CCSGG 1 cut(s) 207
AsuHPI GGTGA 1 cut(s) 142
BccI CCATC 3 cut(s) 95, 263, 266
BcnI CCSGG 1 cut(s) 207
BfaI CTAG 1 cut(s) 224
BisI GCNGC 1 cut(s) 21
BlsI GCNGC 1 cut(s) 22
Bme1390I CCNGG 1 cut(s) 207
BmiI GGNNCC 1 cut(s) 274
BmrFI CCNGG 1 cut(s) 207
BmsI GCATC 1 cut(s) 81
BplI GAGNNNNNCTC 2 cut(s) 185, 217
BpuMI CCSGG 1 cut(s) 207
BsaJI CCNNGG 1 cut(s) 206
Bsc4I CCNNNNNNNGG 1 cut(s) 47
BseDI CCNNGG 1 cut(s) 206
BseGI GGATG 1 cut(s) 258
BseLI CCNNNNNNNGG 1 cut(s) 47
BseMII CTCAG 3 cut(s) 63, 131, 204
BsiSI CCGG 1 cut(s) 206
BslI CCNNNNNNNGG 1 cut(s) 47
BspACI CCGC 1 cut(s) 20
BspCNI CTCAG 3 cut(s) 64, 132, 203
BspLI GGNNCC 1 cut(s) 274
BssECI CCNNGG 1 cut(s) 206
Bst4CI ACNGT 2 cut(s) 238, 277
BstDEI CTNAG 3 cut(s) 72, 140, 190
BstF5I GGATG 1 cut(s) 258
BstSCI CCNGG 1 cut(s) 205
BtsCI GGATG 1 cut(s) 258
CaiI CAGNNNCTG 1 cut(s) 71
Csp6I GTAC 1 cut(s) 165
CviAII CATG 1 cut(s) 254
CviJI RGCY 4 cut(s) 8, 23, 189, 223
CviKI_1 RGCY 4 cut(s) 8, 23, 189, 223
CviQI GTAC 1 cut(s) 165
DdeI CTNAG 3 cut(s) 72, 140, 190
FaeI CATG 1 cut(s) 257
FatI CATG 1 cut(s) 253
Fnu4HI GCNGC 1 cut(s) 21
FokI GGATG 1 cut(s) 245
Fsp4HI GCNGC 1 cut(s) 21
FspBI CTAG 1 cut(s) 224
GluI GCNGC 1 cut(s) 21
HapII CCGG 1 cut(s) 206
Hin1II CATG 1 cut(s) 257
HincII GTYRAC 1 cut(s) 181
HindII GTYRAC 1 cut(s) 181
HinfI GANTC 2 cut(s) 28, 62
HpaII CCGG 1 cut(s) 206
HphI GGTGA 1 cut(s) 142
Hpy166II GTNNAC 2 cut(s) 113, 181
Hpy188I TCNGA 2 cut(s) 193, 268
Hpy8I GTNNAC 2 cut(s) 113, 181
HpyCH4III ACNGT 2 cut(s) 238, 277
HpyF3I CTNAG 3 cut(s) 72, 140, 190
Hsp92II CATG 1 cut(s) 257
LpnPI CCDG 2 cut(s) 84, 219
LweI GCATC 1 cut(s) 81
MaeI CTAG 1 cut(s) 224
MaeIII GTNAC 2 cut(s) 34, 280
MboII GAAGA 1 cut(s) 94
MluCI AATT 1 cut(s) 76
MnlI CCTC 3 cut(s) 121, 187, 272
MseI TTAA 1 cut(s) 87
MspI CCGG 1 cut(s) 206
MspR9I CCNGG 1 cut(s) 207
NciI CCSGG 1 cut(s) 207
NlaIII CATG 1 cut(s) 257
NlaIV GGNNCC 1 cut(s) 274
PfeI GAWTC 2 cut(s) 28, 62
PkrI GCNGC 1 cut(s) 22
PspN4I GGNNCC 1 cut(s) 274
PsrI GAACNNNNNNTAC 1 cut(s) 265
PstNI CAGNNNCTG 1 cut(s) 71
RsaI GTAC 1 cut(s) 166
RsaNI GTAC 1 cut(s) 165
SaqAI TTAA 1 cut(s) 87
SatI GCNGC 1 cut(s) 21
ScrFI CCNGG 1 cut(s) 207
SetI ASST 4 cut(s) 10, 73, 132, 191
SfaNI GCATC 1 cut(s) 81
Sse9I AATT 1 cut(s) 76
SsiI CCGC 1 cut(s) 20
SspMI CTAG 1 cut(s) 224
StyD4I CCNGG 1 cut(s) 205
TaaI ACNGT 2 cut(s) 238, 277
TaqI TCGA 1 cut(s) 291
TasI AATT 1 cut(s) 76
TauI GCSGC 1 cut(s) 23
TfiI GAWTC 2 cut(s) 28, 62
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TspDTI ATGAA 2 cut(s) 69, 242
XspI CTAG 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.