Rmu_co8325273.1_g000001

B3 domain-containing transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8325273.1
Physical Location & Seq
Forward (+)
182 .. 906
725 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8325273.1_g000001.1.cds

Sequence Viewer

Length: 447 bp
atgtatgtgctcgagaatactggggaattcgttagcacacatggcttgcaacttggagatttcatcatggtttatcaagatagtgcaaaccacaattatgtcattcaggctaaaaaggccaactctgtccaagatgatgatgaagaagatgaaactgtatatggagtggaagaaactatgaacaatgctgtgaatgagctcatgatttatgactcggtccctgatcaggctaacaagtctagctcgttttacatgccgacaatggatcatgatcatatgcaggatgttaatgcaggcatgtcatttgtgtatgacaccactgccttctcaaacgactctctccttgattttttgggtggatccatgaccaactattccagatcaaatggacgtctgcaggaaaattttgggtctgttgagaacctgtctcttgatgacttctattaa

Protein Analysis

148

Amino Acids

16.7

Weight (kDa)

4.05

Isoelectric Point (pI)

48.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014501)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G26790
fragaria_vesca FvH4_6g54170
malus_domestica MD09G1004700.v1.1 MD17G1008700.v1.1
prunus_persica Prupe.3G312100_v2.0.a1
pyrus_communis pycom17g00360
rosa_chinensis RchiOBHm_Chr2g0176341
rosa_laevigata RLG00000022405
rosa_multiflora Rmu_co8325273.1_g000001 Rmu_sc0027060.1_g000003
rosa_roxburghii Rroxscaffold_2G00076550
rosa_rugosa Rorug02G0593400
rosa_samantha Rh2AG671900 Rh2BG683400 Rh2CG646100 Rh2DG696900
rosa_wichuraiana Rw2G055100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 394
AclWI GGATC 3 cut(s) 273, 354, 367
AcsI RAATTY 2 cut(s) 26, 403
AcyI GRCGYC 1 cut(s) 391
AfiI CCNNNNNNNGG 1 cut(s) 226
AluBI AGCT 2 cut(s) 199, 243
AluI AGCT 2 cut(s) 199, 243
Alw21I GWGCWC 2 cut(s) 12, 201
Alw26I GTCTC 1 cut(s) 432
AlwI GGATC 3 cut(s) 273, 354, 367
Ama87I CYCGRG 1 cut(s) 11
AoxI GGCC 1 cut(s) 117
ApoI RAATTY 2 cut(s) 26, 403
AspS9I GGNCC 1 cut(s) 217
AvaI CYCGRG 1 cut(s) 11
AvaII GGWCC 1 cut(s) 217
BamHI GGATCC 1 cut(s) 359
BanII GRGCYC 1 cut(s) 201
Bbv12I GWGCWC 2 cut(s) 12, 201
BclI TGATCA 2 cut(s) 223, 271
BcoDI GTCTC 1 cut(s) 432
BfaI CTAG 1 cut(s) 240
BfmI CTRYAG 1 cut(s) 395
Bme18I GGWCC 1 cut(s) 217
BmeT110I CYCGRG 1 cut(s) 11
BmgT120I GGNCC 1 cut(s) 217
BmiI GGNNCC 2 cut(s) 219, 361
BmrI ACTGGG 1 cut(s) 30
BmuI ACTGGG 1 cut(s) 30
BsaBI GATNNNNATC 1 cut(s) 270
BsaHI GRCGYC 1 cut(s) 391
Bsc4I CCNNNNNNNGG 1 cut(s) 226
Bse1I ACTGG 1 cut(s) 25
Bse8I GATNNNNATC 1 cut(s) 270
BseGI GGATG 1 cut(s) 289
BseJI GATNNNNATC 1 cut(s) 270
BseLI CCNNNNNNNGG 1 cut(s) 226
BseNI ACTGG 1 cut(s) 25
BshFI GGCC 1 cut(s) 119
BsiHKAI GWGCWC 2 cut(s) 12, 201
BsiHKCI CYCGRG 1 cut(s) 11
BslFI GGGAC 1 cut(s) 203
BslI CCNNNNNNNGG 1 cut(s) 226
BsmAI GTCTC 1 cut(s) 432
BsmFI GGGAC 1 cut(s) 203
BsnI GGCC 1 cut(s) 119
BsoBI CYCGRG 1 cut(s) 11
Bsp1286I GDGCHC 2 cut(s) 12, 201
Bsp143I GATC 5 cut(s) 223, 265, 271, 359, 380
BspANI GGCC 1 cut(s) 119
BspHI TCATGA 2 cut(s) 201, 268
BspLI GGNNCC 2 cut(s) 219, 361
BspMAI CTGCAG 1 cut(s) 399
BspPI GGATC 3 cut(s) 273, 354, 367
BsrI ACTGG 1 cut(s) 25
BssMI GATC 5 cut(s) 223, 265, 271, 359, 380
BssNI GRCGYC 1 cut(s) 391
Bst4CI ACNGT 1 cut(s) 157
BstACI GRCGYC 1 cut(s) 391
BstC8I GCNNGC 2 cut(s) 47, 295
BstF5I GGATG 1 cut(s) 289
BstKTI GATC 5 cut(s) 226, 268, 274, 362, 383
BstMAI GTCTC 1 cut(s) 432
BstMBI GATC 5 cut(s) 223, 265, 271, 359, 380
BstMWI GCNNNNNNNGC 2 cut(s) 42, 116
BstNSI RCATGY 2 cut(s) 256, 301
BstSFI CTRYAG 1 cut(s) 395
BstX2I RGATCY 1 cut(s) 359
BstYI RGATCY 1 cut(s) 359
BsuRI GGCC 1 cut(s) 119
BtsCI GGATG 1 cut(s) 289
BtsI GCAGTG 1 cut(s) 318
BtsIMutI CAGTG 1 cut(s) 318
Cac8I GCNNGC 2 cut(s) 47, 295
CciI TCATGA 2 cut(s) 201, 268
Cfr13I GGNCC 1 cut(s) 217
CviAII CATG 7 cut(s) 41, 67, 202, 253, 269, 298, 364
CviJI RGCY 6 cut(s) 45, 110, 119, 199, 230, 243
CviKI_1 RGCY 6 cut(s) 45, 110, 119, 199, 230, 243
DpnI GATC 5 cut(s) 225, 267, 273, 361, 382
DpnII GATC 5 cut(s) 223, 265, 271, 359, 380
Ecl136II GAGCTC 1 cut(s) 199
Eco24I GRGCYC 1 cut(s) 201
Eco47I GGWCC 1 cut(s) 217
Eco53kI GAGCTC 1 cut(s) 199
Eco88I CYCGRG 1 cut(s) 11
EcoICRI GAGCTC 1 cut(s) 199
EcoRI GAATTC 1 cut(s) 26
EcoT38I GRGCYC 1 cut(s) 201
FaeI CATG 7 cut(s) 44, 70, 205, 256, 272, 301, 367
FaqI GGGAC 1 cut(s) 203
FatI CATG 7 cut(s) 40, 66, 201, 252, 268, 297, 363
FauNDI CATATG 1 cut(s) 276
FbaI TGATCA 2 cut(s) 223, 271
FokI GGATG 1 cut(s) 296
FriOI GRGCYC 1 cut(s) 201
FspBI CTAG 1 cut(s) 240
HaeIII GGCC 1 cut(s) 119
Hin1I GRCGYC 1 cut(s) 391
Hin1II CATG 7 cut(s) 44, 70, 205, 256, 272, 301, 367
HinfI GANTC 2 cut(s) 212, 335
Hpy188III TCNNGA 6 cut(s) 13, 77, 202, 269, 378, 431
HpyAV CCTTC 1 cut(s) 334
HpyCH4III ACNGT 1 cut(s) 157
HpyCH4IV ACGT 1 cut(s) 391
HpyCH4V TGCA 5 cut(s) 49, 86, 280, 293, 397
HpyF10VI GCNNNNNNNGC 2 cut(s) 42, 116
HpySE526I ACGT 1 cut(s) 391
Hsp92I GRCGYC 1 cut(s) 391
Hsp92II CATG 7 cut(s) 44, 70, 205, 256, 272, 301, 367
Ksp22I TGATCA 2 cut(s) 223, 271
Kzo9I GATC 5 cut(s) 223, 265, 271, 359, 380
LpnPI CCDG 9 cut(s) 6, 92, 212, 234, 266, 279, 383, 391, 437
MaeI CTAG 1 cut(s) 240
MaeII ACGT 1 cut(s) 391
MalI GATC 5 cut(s) 225, 267, 273, 361, 382
MboI GATC 5 cut(s) 223, 265, 271, 359, 380
MboII GAAGA 3 cut(s) 155, 158, 182
MflI RGATCY 1 cut(s) 359
MhlI GDGCHC 2 cut(s) 12, 201
MluCI AATT 3 cut(s) 26, 94, 403
MlyI GAGTC 2 cut(s) 206, 329
MseI TTAA 2 cut(s) 288, 445
MslI CAYNNNNRTG 1 cut(s) 96
MwoI GCNNNNNNNGC 2 cut(s) 42, 116
NdeI CATATG 1 cut(s) 276
NdeII GATC 5 cut(s) 223, 265, 271, 359, 380
NlaIII CATG 7 cut(s) 44, 70, 205, 256, 272, 301, 367
NlaIV GGNNCC 2 cut(s) 219, 361
NspI RCATGY 2 cut(s) 256, 301
PaeR7I CTCGAG 1 cut(s) 11
PagI TCATGA 2 cut(s) 201, 268
PflFI GACNNNGTC 1 cut(s) 215
PleI GAGTC 2 cut(s) 206, 329
PpsI GAGTC 2 cut(s) 206, 329
Psp124BI GAGCTC 1 cut(s) 201
PspN4I GGNNCC 2 cut(s) 219, 361
PspPI GGNCC 1 cut(s) 217
PstI CTGCAG 1 cut(s) 399
PsuI RGATCY 1 cut(s) 359
PsyI GACNNNGTC 1 cut(s) 215
RseI CAYNNNNRTG 1 cut(s) 96
SacI GAGCTC 1 cut(s) 201
SaqAI TTAA 2 cut(s) 288, 445
Sau3AI GATC 5 cut(s) 223, 265, 271, 359, 380
Sau96I GGNCC 1 cut(s) 217
SchI GAGTC 2 cut(s) 206, 329
SduI GDGCHC 2 cut(s) 12, 201
SetI ASST 4 cut(s) 201, 245, 394, 426
SfcI CTRYAG 1 cut(s) 395
Sfr274I CTCGAG 1 cut(s) 11
SinI GGWCC 1 cut(s) 217
SlaI CTCGAG 1 cut(s) 11
SmiMI CAYNNNNRTG 1 cut(s) 96
SmlI CTYRAG 1 cut(s) 11
SmoI CTYRAG 1 cut(s) 11
Sse9I AATT 3 cut(s) 26, 94, 403
SspMI CTAG 1 cut(s) 240
SstI GAGCTC 1 cut(s) 201
TaaI ACNGT 1 cut(s) 157
TaiI ACGT 1 cut(s) 394
TaqI TCGA 1 cut(s) 12
TaqII GACCGA 1 cut(s) 205
TasI AATT 3 cut(s) 26, 94, 403
Tru1I TTAA 2 cut(s) 288, 445
Tru9I TTAA 2 cut(s) 288, 445
TscAI CASTG 1 cut(s) 325
TspDTI ATGAA 4 cut(s) 52, 156, 165, 194
TspRI CASTG 1 cut(s) 325
Tth111I GACNNNGTC 1 cut(s) 215
VpaK11BI GGWCC 1 cut(s) 217
XapI RAATTY 2 cut(s) 26, 403
XceI RCATGY 2 cut(s) 256, 301
XhoI CTCGAG 1 cut(s) 11
XspI CTAG 1 cut(s) 240
ZraI GACGTC 1 cut(s) 392
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.