Rorug02G0593400

B3 domain-containing transcription factor

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
71529505 .. 71530158
654 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0593400.1

Sequence Viewer

Length: 528 bp
ATGAGGAATTCAAGTGCGGACTTAAGTTTTGTTGCCAAAGCACTCCGCATATTTGGCTCTCTTATTTTCTTGCTTTTGTTCCTTCACCTCAATAATGTTGAAGGAATTCGGATAGAAAGATCTACATCAGTAACGGAAAAACAAAACATCCATGAACATGGTGAAGGAATGGATGATGTTGTTGAGTTTGAGGTGAATTCTCTTCCTACAACACATCCTCTTGAAAACTACCCAGATGGTGAAGATGAGATCTATGTTGATTACTCTCCTCCAAAGACACATCCTCCAAAATCACCTCCAACATATGCAAGAACAGACCCTCCAACTCAACCGCCGACGTTGAAAGGTGATTCACATGGCAAAGATGAATTTGGTGCGGACTATTCTCTTCCTACAACACATCCTCCTGAAAACTACCCAGATGGTGAAGATGAGATCTATGTTGAATACTCTCCTCCGAAGACACATCCTCCTCCAAAATCACCTCCAACATATGCAGAAATCACACACATGCACAAATCCCTATAA

Protein Analysis

175

Amino Acids

19.65

Weight (kDa)

4.98

Isoelectric Point (pI)

54.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014501)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G26790
fragaria_vesca FvH4_6g54170
malus_domestica MD09G1004700.v1.1 MD17G1008700.v1.1
prunus_persica Prupe.3G312100_v2.0.a1
pyrus_communis pycom17g00360
rosa_chinensis RchiOBHm_Chr2g0176341
rosa_laevigata RLG00000022405
rosa_multiflora Rmu_co8325273.1_g000001 Rmu_sc0027060.1_g000003
rosa_roxburghii Rroxscaffold_2G00076550
rosa_rugosa Rorug02G0593400
rosa_samantha Rh2AG671900 Rh2BG683400 Rh2CG646100 Rh2DG696900
rosa_wichuraiana Rw2G055100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 17, 46, 332, 377
AcsI RAATTY 4 cut(s) 7, 105, 196, 368
AflII CTTAAG 1 cut(s) 22
AgsI TTSAA 5 cut(s) 12, 101, 224, 343, 446
AloI GAACNNNNNNTCC 2 cut(s) 304, 336
ApoI RAATTY 4 cut(s) 7, 105, 196, 368
ArsI GACNNNNNNTTYG 2 cut(s) 11, 43
Asp700I GAANNNNTTC 1 cut(s) 105
AsuHPI GGTGA 8 cut(s) 77, 173, 205, 251, 285, 359, 437, 474
BbsI GAAGAC 1 cut(s) 467
BccI CCATC 2 cut(s) 230, 416
BfrI CTTAAG 1 cut(s) 22
BglII AGATCT 3 cut(s) 119, 249, 435
BpiI GAAGAC 1 cut(s) 467
BsaBI GATNNNNATC 1 cut(s) 124
BsaXI ACNNNNNCTCC 8 cut(s) 268, 298, 304, 334, 388, 418, 454, 484
Bse8I GATNNNNATC 1 cut(s) 124
BseGI GGATG 6 cut(s) 147, 178, 214, 280, 400, 466
BseJI GATNNNNATC 1 cut(s) 124
BseRI GAGGAG 3 cut(s) 258, 444, 462
Bsp143I GATC 3 cut(s) 119, 249, 435
BspACI CCGC 4 cut(s) 17, 46, 332, 377
BspTI CTTAAG 1 cut(s) 22
BssMI GATC 3 cut(s) 119, 249, 435
Bst6I CTCTTC 2 cut(s) 207, 393
BstAFI CTTAAG 1 cut(s) 22
BstF5I GGATG 6 cut(s) 147, 178, 214, 280, 400, 466
BstKTI GATC 3 cut(s) 122, 252, 438
BstMBI GATC 3 cut(s) 119, 249, 435
BstMWI GCNNNNNNNGC 1 cut(s) 54
BstNSI RCATGY 1 cut(s) 514
BstV2I GAAGAC 1 cut(s) 467
BstX2I RGATCY 3 cut(s) 119, 249, 435
BstXI CCANNNNNNTGG 1 cut(s) 158
BstYI RGATCY 3 cut(s) 119, 249, 435
BtsCI GGATG 6 cut(s) 147, 178, 214, 280, 400, 466
CviAII CATG 4 cut(s) 152, 158, 356, 511
CviJI RGCY 1 cut(s) 57
CviKI_1 RGCY 1 cut(s) 57
DpnI GATC 3 cut(s) 121, 251, 437
DpnII GATC 3 cut(s) 119, 249, 435
Eam1104I CTCTTC 2 cut(s) 207, 393
EarI CTCTTC 2 cut(s) 207, 393
EcoRI GAATTC 3 cut(s) 7, 105, 196
FaeI CATG 4 cut(s) 155, 161, 359, 514
FatI CATG 4 cut(s) 151, 157, 355, 510
FauNDI CATATG 2 cut(s) 304, 493
FokI GGATG 6 cut(s) 134, 185, 201, 267, 387, 453
Hin1II CATG 4 cut(s) 155, 161, 359, 514
HinfI GANTC 1 cut(s) 350
HphI GGTGA 8 cut(s) 77, 173, 205, 251, 285, 359, 437, 474
Hpy188I TCNGA 2 cut(s) 111, 459
Hpy188III TCNNGA 2 cut(s) 221, 407
Hpy99I CGWCG 1 cut(s) 340
HpyAV CCTTC 3 cut(s) 92, 95, 158
HpyCH4IV ACGT 1 cut(s) 338
HpyCH4V TGCA 3 cut(s) 308, 497, 514
HpyF10VI GCNNNNNNNGC 1 cut(s) 54
HpySE526I ACGT 1 cut(s) 338
Hsp92II CATG 4 cut(s) 155, 161, 359, 514
Kzo9I GATC 3 cut(s) 119, 249, 435
LpnPI CCDG 3 cut(s) 246, 420, 432
MaeII ACGT 1 cut(s) 338
MaeIII GTNAC 1 cut(s) 130
MalI GATC 3 cut(s) 121, 251, 437
MboI GATC 3 cut(s) 119, 249, 435
MboII GAAGA 5 cut(s) 194, 254, 380, 440, 472
MflI RGATCY 3 cut(s) 119, 249, 435
MluCI AATT 4 cut(s) 7, 105, 196, 368
MmeI TCCRAC 3 cut(s) 323, 347, 512
MroXI GAANNNNTTC 1 cut(s) 105
MseI TTAA 1 cut(s) 23
MslI CAYNNNNRTG 2 cut(s) 156, 509
MspCI CTTAAG 1 cut(s) 22
MwoI GCNNNNNNNGC 1 cut(s) 54
NdeI CATATG 2 cut(s) 304, 493
NdeII GATC 3 cut(s) 119, 249, 435
NlaIII CATG 4 cut(s) 155, 161, 359, 514
NspI RCATGY 1 cut(s) 514
PdmI GAANNNNTTC 1 cut(s) 105
PfeI GAWTC 1 cut(s) 350
PsuI RGATCY 3 cut(s) 119, 249, 435
RseI CAYNNNNRTG 2 cut(s) 156, 509
SaqAI TTAA 1 cut(s) 23
Sau3AI GATC 3 cut(s) 119, 249, 435
SetI ASST 6 cut(s) 90, 195, 298, 341, 349, 487
SmiMI CAYNNNNRTG 2 cut(s) 156, 509
SmlI CTYRAG 1 cut(s) 22
SmoI CTYRAG 1 cut(s) 22
Sse9I AATT 4 cut(s) 7, 105, 196, 368
SsiI CCGC 4 cut(s) 17, 46, 332, 377
TaiI ACGT 1 cut(s) 341
TasI AATT 4 cut(s) 7, 105, 196, 368
TfiI GAWTC 1 cut(s) 350
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TspDTI ATGAA 2 cut(s) 168, 381
TspGWI ACGGA 1 cut(s) 149
Vha464I CTTAAG 1 cut(s) 22
XapI RAATTY 4 cut(s) 7, 105, 196, 368
XceI RCATGY 1 cut(s) 514
XmnI GAANNNNTTC 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.