Rmu_co8327239.1_g000001

Cytochrome b-c1 complex subunit 9-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8327239.1
Physical Location & Seq
Reverse (-)
1 .. 860
860 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8327239.1_g000001.1.cds

Sequence Viewer

Length: 168 bp
atggcttcaacacctcgacgaaccggtggaggcctcttcgaagggctctacagggtcatcatgcgccgcaactccgtctacgtcaccttcgtcatcgccggagctttcctcggtgaacgggctgtggattatggagttcataggctgtgggagtacaataacgttggg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.32

Weight (kDa)

9.97

Isoelectric Point (pI)

26.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 78
AciI CCGC 1 cut(s) 67
AclI AACGTT 1 cut(s) 162
AfaI GTAC 1 cut(s) 155
AgeI ACCGGT 1 cut(s) 23
AgsI TTSAA 1 cut(s) 9
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
AoxI GGCC 1 cut(s) 31
AsiGI ACCGGT 1 cut(s) 23
AspLEI GCGC 1 cut(s) 66
AsuHPI GGTGA 2 cut(s) 76, 125
AsuII TTCGAA 1 cut(s) 39
BanII GRGCYC 1 cut(s) 48
BfmI CTRYAG 1 cut(s) 49
BisI GCNGC 1 cut(s) 67
BlsI GCNGC 1 cut(s) 68
BplI GAGNNNNNCTC 2 cut(s) 93, 125
Bpu14I TTCGAA 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 109
BsaWI WCCGGW 1 cut(s) 23
Bse118I RCCGGY 1 cut(s) 23
BseDI CCNNGG 1 cut(s) 109
BshFI GGCC 1 cut(s) 33
BshTI ACCGGT 1 cut(s) 23
BsiSI CCGG 2 cut(s) 24, 99
BsnI GGCC 1 cut(s) 33
Bsp119I TTCGAA 1 cut(s) 39
Bsp1286I GDGCHC 1 cut(s) 48
BspACI CCGC 1 cut(s) 67
BspANI GGCC 1 cut(s) 33
BspT104I TTCGAA 1 cut(s) 39
BsrFI RCCGGY 1 cut(s) 23
BssAI RCCGGY 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 109
Bst6I CTCTTC 1 cut(s) 41
BstBI TTCGAA 1 cut(s) 39
BstHHI GCGC 1 cut(s) 66
BstSFI CTRYAG 1 cut(s) 49
BsuRI GGCC 1 cut(s) 33
BtgZI GCGATG 1 cut(s) 79
CfoI GCGC 1 cut(s) 66
Cfr10I RCCGGY 1 cut(s) 23
Csp6I GTAC 1 cut(s) 154
CspAI ACCGGT 1 cut(s) 23
CviAII CATG 1 cut(s) 61
CviJI RGCY 6 cut(s) 5, 33, 46, 104, 122, 145
CviKI_1 RGCY 6 cut(s) 5, 33, 46, 104, 122, 145
CviQI GTAC 1 cut(s) 154
Eam1104I CTCTTC 1 cut(s) 41
EarI CTCTTC 1 cut(s) 41
Eco147I AGGCCT 1 cut(s) 33
Eco24I GRGCYC 1 cut(s) 48
EcoT38I GRGCYC 1 cut(s) 48
FaeI CATG 1 cut(s) 64
FaiI YATR 3 cut(s) 62, 132, 141
FatI CATG 1 cut(s) 60
FblI GTMKAC 1 cut(s) 78
Fnu4HI GCNGC 1 cut(s) 67
FriOI GRGCYC 1 cut(s) 48
Fsp4HI GCNGC 1 cut(s) 67
GlaI GCGC 1 cut(s) 65
GluI GCNGC 1 cut(s) 67
HaeIII GGCC 1 cut(s) 33
HapII CCGG 2 cut(s) 24, 99
HhaI GCGC 1 cut(s) 66
Hin1II CATG 1 cut(s) 64
Hin6I GCGC 1 cut(s) 64
HinP1I GCGC 1 cut(s) 64
HpaII CCGG 2 cut(s) 24, 99
HphI GGTGA 2 cut(s) 76, 125
Hpy166II GTNNAC 2 cut(s) 79, 116
Hpy8I GTNNAC 2 cut(s) 79, 116
Hpy99I CGWCG 1 cut(s) 21
HpyAV CCTTC 2 cut(s) 35, 97
HpyCH4IV ACGT 2 cut(s) 81, 162
HpySE526I ACGT 2 cut(s) 81, 162
Hsp92II CATG 1 cut(s) 64
HspAI GCGC 1 cut(s) 64
LmnI GCTCC 1 cut(s) 101
LpnPI CCDG 3 cut(s) 37, 37, 112
MaeII ACGT 2 cut(s) 81, 162
MaeIII GTNAC 1 cut(s) 82
MboII GAAGA 1 cut(s) 28
MhlI GDGCHC 1 cut(s) 48
MnlI CCTC 4 cut(s) 23, 24, 44, 119
MspI CCGG 2 cut(s) 24, 99
NlaIII CATG 1 cut(s) 64
NmuCI GTSAC 1 cut(s) 82
NspV TTCGAA 1 cut(s) 39
PceI AGGCCT 1 cut(s) 33
PcsI WCGNNNNNNNCGW 1 cut(s) 87
PinAI ACCGGT 1 cut(s) 23
PkrI GCNGC 1 cut(s) 68
Psp1406I AACGTT 1 cut(s) 162
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
SatI GCNGC 1 cut(s) 67
SduI GDGCHC 1 cut(s) 48
SetI ASST 5 cut(s) 16, 84, 89, 106, 165
SfcI CTRYAG 1 cut(s) 49
SfuI TTCGAA 1 cut(s) 39
SgeI CNNG 7 cut(s) 27, 36, 64, 73, 111, 122, 131
SseBI AGGCCT 1 cut(s) 33
SsiI CCGC 1 cut(s) 67
StuI AGGCCT 1 cut(s) 33
TaiI ACGT 2 cut(s) 84, 165
TaqI TCGA 2 cut(s) 16, 39
TatI WGTACW 1 cut(s) 153
TauI GCSGC 1 cut(s) 69
TseFI GTSAC 1 cut(s) 82
Tsp45I GTSAC 1 cut(s) 82
TspDTI ATGAA 1 cut(s) 128
TspGWI ACGGA 1 cut(s) 64
XmiI GTMKAC 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.