Rmu_co8376349.1_g000001

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8376349.1
Physical Location & Seq
Reverse (-)
273 .. 1031
759 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8376349.1_g000001.1.cds

Sequence Viewer

Length: 759 bp
atgcatggaactccagctcaatctcaaagcagtgcagctaataatagaaatctcattgcctctagtaagccaacagctgggactcctattggggtagaaccgaatgttgtagctgctgcctctgctgcccttggtgcaatcatgaatggcaataatgaacatggaaatatgattgaccatgaattgctgattcagattctgagcaacccaaagatgattgagaaattggttacagatccacaggcagtgactagatcaccatccatgacttcatcagatccattcccgcttcacattaataacacagaaagtattgcacctttgtcaaccgctccatcaagtggacatttctatcctcaggcaaatatgggtggaatgggacatctttctgatcaatctttgttatcaagcattccagtttcctcctcgccttctgtcggaccaccaccagcaaaggatatcaactattataaaagcttgattcaacaacatggaggggataggcacgactccttcccaccattcggcaatcgtcctagccaccattcggcaaaccaagaatccttcaatggttacaaatcaagggattcaaagcctaagattatgaagccttgcatatacttcaatagttcaagggggtgccgccatggagcaaattgttcattccaacatgatgcatctttccaacagcagggtagtcgtgtgcccgaggtccagaatgctaagagaatgaaagttgatagggagataagtagttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

252

Amino Acids

27.02

Weight (kDa)

8.78

Isoelectric Point (pI)

57.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 471
AccB1I GGYRCC 1 cut(s) 639
AccB7I CCANNNNNTGG 2 cut(s) 77, 341
AccBSI CCGCTC 1 cut(s) 332
AciI CCGC 3 cut(s) 287, 330, 643
AclWI GGATC 2 cut(s) 230, 272
AfiI CCNNNNNNNGG 6 cut(s) 77, 341, 437, 524, 547, 691
AgsI TTSAA 5 cut(s) 485, 568, 591, 625, 633
AluBI AGCT 5 cut(s) 17, 38, 77, 113, 477
AluI AGCT 5 cut(s) 17, 38, 77, 113, 477
AlwI GGATC 2 cut(s) 230, 272
AlwNI CAGNNNCTG 1 cut(s) 199
Ama87I CYCGRG 1 cut(s) 707
ApeKI GCWGC 4 cut(s) 35, 113, 116, 125
AseI ATTAAT 1 cut(s) 297
AspS9I GGNCC 2 cut(s) 440, 712
AsuHPI GGTGA 1 cut(s) 249
AvaI CYCGRG 1 cut(s) 707
AvaII GGWCC 2 cut(s) 440, 712
AxyI CCTNAGG 1 cut(s) 357
BaeGI GKGCMC 1 cut(s) 708
BanI GGYRCC 1 cut(s) 639
BbvI GCAGC 4 cut(s) 47, 100, 103, 112
BccI CCATC 2 cut(s) 268, 343
BcgI CGANNNNNNTGC 2 cut(s) 680, 714
BclI TGATCA 1 cut(s) 391
BfaI CTAG 3 cut(s) 63, 252, 537
BisI GCNGC 5 cut(s) 36, 114, 117, 126, 643
BlsI GCNGC 5 cut(s) 37, 115, 118, 127, 644
Bme18I GGWCC 2 cut(s) 440, 712
BmeT110I CYCGRG 1 cut(s) 707
BmgT120I GGNCC 2 cut(s) 440, 712
BmiI GGNNCC 1 cut(s) 641
BmsI GCATC 2 cut(s) 664, 686
BsaBI GATNNNNATC 1 cut(s) 259
BsaJI CCNNGG 3 cut(s) 130, 646, 708
Bsc4I CCNNNNNNNGG 6 cut(s) 77, 341, 437, 524, 547, 691
Bse1I ACTGG 1 cut(s) 416
Bse21I CCTNAGG 1 cut(s) 357
Bse3DI GCAATG 1 cut(s) 54
Bse8I GATNNNNATC 1 cut(s) 259
BseDI CCNNGG 3 cut(s) 130, 646, 708
BseGI GGATG 1 cut(s) 260
BseJI GATNNNNATC 1 cut(s) 259
BseLI CCNNNNNNNGG 6 cut(s) 77, 341, 437, 524, 547, 691
BseMI GCAATG 1 cut(s) 54
BseMII CTCAG 2 cut(s) 191, 371
BseNI ACTGG 1 cut(s) 416
BseRI GAGGAG 1 cut(s) 415
BseSI GKGCMC 1 cut(s) 708
BseXI GCAGC 4 cut(s) 47, 100, 103, 112
BseYI CCCAGC 1 cut(s) 77
BsgI GTGCAG 1 cut(s) 54
BshNI GGYRCC 1 cut(s) 639
BsiHKCI CYCGRG 1 cut(s) 707
BslFI GGGAC 2 cut(s) 94, 393
BslI CCNNNNNNNGG 6 cut(s) 77, 341, 437, 524, 547, 691
BsmFI GGGAC 2 cut(s) 94, 393
BsmI GAATGC 2 cut(s) 411, 724
BsoBI CYCGRG 1 cut(s) 707
Bsp1286I GDGCHC 1 cut(s) 708
Bsp143I GATC 4 cut(s) 235, 254, 277, 391
Bsp19I CCATGG 1 cut(s) 646
BspACI CCGC 3 cut(s) 287, 330, 643
BspCNI CTCAG 2 cut(s) 192, 370
BspHI TCATGA 1 cut(s) 141
BspLI GGNNCC 1 cut(s) 641
BspPI GGATC 2 cut(s) 230, 272
BspT107I GGYRCC 1 cut(s) 639
BsrBI CCGCTC 1 cut(s) 332
BsrDI GCAATG 1 cut(s) 54
BsrI ACTGG 1 cut(s) 416
BssECI CCNNGG 3 cut(s) 130, 646, 708
BssMI GATC 4 cut(s) 235, 254, 277, 391
BssT1I CCWWGG 2 cut(s) 130, 646
BstDEI CTNAG 4 cut(s) 200, 357, 597, 723
BstDSI CCRYGG 1 cut(s) 646
BstF5I GGATG 1 cut(s) 260
BstKTI GATC 4 cut(s) 238, 257, 280, 394
BstMBI GATC 4 cut(s) 235, 254, 277, 391
BstMWI GCNNNNNNNGC 3 cut(s) 122, 125, 134
BstSLI GKGCMC 1 cut(s) 708
BstV1I GCAGC 4 cut(s) 47, 100, 103, 112
BstX2I RGATCY 2 cut(s) 235, 277
BstYI RGATCY 2 cut(s) 235, 277
Bsu36I CCTNAGG 1 cut(s) 357
BtgI CCRYGG 1 cut(s) 646
BtsCI GGATG 1 cut(s) 260
BtsI GCAGTG 2 cut(s) 37, 252
BtsIMutI CAGTG 2 cut(s) 37, 252
CaiI CAGNNNCTG 1 cut(s) 199
CciI TCATGA 1 cut(s) 141
Cfr13I GGNCC 2 cut(s) 440, 712
CviAII CATG 8 cut(s) 5, 142, 161, 179, 265, 491, 647, 671
CviJI RGCY 9 cut(s) 17, 38, 70, 77, 113, 477, 540, 595, 610
CviKI_1 RGCY 9 cut(s) 17, 38, 70, 77, 113, 477, 540, 595, 610
DdeI CTNAG 4 cut(s) 200, 357, 597, 723
DpnI GATC 4 cut(s) 237, 256, 279, 393
DpnII GATC 4 cut(s) 235, 254, 277, 391
Eco130I CCWWGG 2 cut(s) 130, 646
Eco32I GATATC 1 cut(s) 460
Eco47I GGWCC 2 cut(s) 440, 712
Eco81I CCTNAGG 1 cut(s) 357
Eco88I CYCGRG 1 cut(s) 707
EcoRV GATATC 1 cut(s) 460
EcoT14I CCWWGG 2 cut(s) 130, 646
EcoT22I ATGCAT 2 cut(s) 6, 679
ErhI CCWWGG 2 cut(s) 130, 646
FaeI CATG 8 cut(s) 8, 145, 164, 182, 268, 494, 650, 674
FaqI GGGAC 2 cut(s) 94, 393
FatI CATG 8 cut(s) 4, 141, 160, 178, 264, 490, 646, 670
FauI CCCGC 1 cut(s) 294
FbaI TGATCA 1 cut(s) 391
Fnu4HI GCNGC 5 cut(s) 36, 114, 117, 126, 643
FokI GGATG 1 cut(s) 247
Fsp4HI GCNGC 5 cut(s) 36, 114, 117, 126, 643
FspBI CTAG 3 cut(s) 63, 252, 537
GluI GCNGC 5 cut(s) 36, 114, 117, 126, 643
GsaI CCCAGC 1 cut(s) 81
Hin1II CATG 8 cut(s) 8, 145, 164, 182, 268, 494, 650, 674
HincII GTYRAC 1 cut(s) 327
HindII GTYRAC 1 cut(s) 327
HindIII AAGCTT 1 cut(s) 475
HinfI GANTC 7 cut(s) 82, 190, 196, 481, 509, 560, 587
HphI GGTGA 1 cut(s) 249
Hpy166II GTNNAC 2 cut(s) 327, 344
Hpy188I TCNGA 5 cut(s) 195, 201, 277, 391, 440
Hpy188III TCNNGA 2 cut(s) 142, 715
Hpy8I GTNNAC 2 cut(s) 327, 344
HpyAV CCTTC 3 cut(s) 441, 523, 574
HpyCH4V TGCA 6 cut(s) 4, 35, 137, 317, 615, 677
HpyF10VI GCNNNNNNNGC 3 cut(s) 122, 125, 134
HpyF3I CTNAG 4 cut(s) 200, 357, 597, 723
Hsp92II CATG 8 cut(s) 8, 145, 164, 182, 268, 494, 650, 674
Ksp22I TGATCA 1 cut(s) 391
Kzo9I GATC 4 cut(s) 235, 254, 277, 391
LmnI GCTCC 2 cut(s) 337, 650
LpnPI CCDG 8 cut(s) 27, 63, 227, 344, 429, 462, 677, 728
Lsp1109I GCAGC 4 cut(s) 47, 100, 103, 112
LweI GCATC 2 cut(s) 664, 686
MaeI CTAG 3 cut(s) 63, 252, 537
MaeIII GTNAC 3 cut(s) 229, 247, 572
MalI GATC 4 cut(s) 237, 256, 279, 393
MbiI CCGCTC 1 cut(s) 332
MboI GATC 4 cut(s) 235, 254, 277, 391
MflI RGATCY 2 cut(s) 235, 277
MhlI GDGCHC 1 cut(s) 708
MluCI AATT 3 cut(s) 182, 224, 655
MlyI GAGTC 2 cut(s) 76, 503
MmeI TCCRAC 3 cut(s) 418, 691, 709
MnlI CCTC 7 cut(s) 70, 130, 366, 433, 436, 488, 703
Mph1103I ATGCAT 2 cut(s) 6, 679
MseI TTAA 2 cut(s) 297, 757
MspA1I CMGCKG 1 cut(s) 77
Mva1269I GAATGC 2 cut(s) 411, 724
MwoI GCNNNNNNNGC 3 cut(s) 122, 125, 134
NcoI CCATGG 1 cut(s) 646
NdeII GATC 4 cut(s) 235, 254, 277, 391
NlaIII CATG 8 cut(s) 8, 145, 164, 182, 268, 494, 650, 674
NlaIV GGNNCC 1 cut(s) 641
NmuCI GTSAC 1 cut(s) 247
NsiI ATGCAT 2 cut(s) 6, 679
PagI TCATGA 1 cut(s) 141
PctI GAATGC 2 cut(s) 411, 724
PfeI GAWTC 5 cut(s) 190, 196, 481, 560, 587
PflMI CCANNNNNTGG 2 cut(s) 77, 341
PkrI GCNGC 5 cut(s) 37, 115, 118, 127, 644
PleI GAGTC 2 cut(s) 76, 503
PpsI GAGTC 2 cut(s) 76, 503
PshBI ATTAAT 1 cut(s) 297
PsiI TTATAA 1 cut(s) 471
PspFI CCCAGC 1 cut(s) 77
PspN4I GGNNCC 1 cut(s) 641
PspPI GGNCC 2 cut(s) 440, 712
PstNI CAGNNNCTG 1 cut(s) 199
PsuI RGATCY 2 cut(s) 235, 277
PvuII CAGCTG 1 cut(s) 77
SaqAI TTAA 2 cut(s) 297, 757
SatI GCNGC 5 cut(s) 36, 114, 117, 126, 643
Sau3AI GATC 4 cut(s) 235, 254, 277, 391
Sau96I GGNCC 2 cut(s) 440, 712
SchI GAGTC 2 cut(s) 76, 503
SduI GDGCHC 1 cut(s) 708
SetI ASST 7 cut(s) 19, 40, 79, 115, 322, 479, 714
SfaNI GCATC 2 cut(s) 664, 686
SinI GGWCC 2 cut(s) 440, 712
Sse9I AATT 3 cut(s) 182, 224, 655
SsiI CCGC 3 cut(s) 287, 330, 643
SspMI CTAG 3 cut(s) 63, 252, 537
StyI CCWWGG 2 cut(s) 130, 646
TasI AATT 3 cut(s) 182, 224, 655
TauI GCSGC 1 cut(s) 645
TfiI GAWTC 5 cut(s) 190, 196, 481, 560, 587
Tru1I TTAA 2 cut(s) 297, 757
Tru9I TTAA 2 cut(s) 297, 757
TscAI CASTG 2 cut(s) 37, 252
TseFI GTSAC 1 cut(s) 247
TseI GCWGC 4 cut(s) 35, 113, 116, 125
Tsp45I GTSAC 1 cut(s) 247
TspDTI ATGAA 7 cut(s) 158, 171, 195, 261, 620, 651, 746
TspRI CASTG 2 cut(s) 37, 252
Van91I CCANNNNNTGG 2 cut(s) 77, 341
VpaK11BI GGWCC 2 cut(s) 440, 712
VspI ATTAAT 1 cut(s) 297
XspI CTAG 3 cut(s) 63, 252, 537
Zsp2I ATGCAT 2 cut(s) 6, 679
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.