Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8386287.1

Orthogroup ID

OG0005725

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1031

Gene Structure 1031 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8386287.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 415 bp

atatttggctgaactactagcagagaagcaaaagttgggaccatttgtgcaggttttgccgctatgtagcagacttctaagtcatgagatcagaagggtgtcgggcttcaatcaaactcttgcagatcatgaaatacttgagcgtgaaagtccatacagatcattaggtcaacacacaaatggtagaccaatggatttggagggatggtcaggaatgcaaatggaggaaaatggacatatccaacggatggtcccgtttcaatctccttcgatggtttggcctggggtgcaaggaattccaaccactcctattgtaaagagagttattagacttgatgttccggtggacaaatatccacatgtaagaagggatcttttagttgatatagagtttgattttgacccctttttttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

KH_1 STAR_dimer

Protein Analysis

137

Amino Acids

15.84

Weight (kDa)

5.94

Isoelectric Point (pI)

53.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005725)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G09660 AT1G09660 AT1G09660
fragaria_vesca	FvH4_5g28270 FvH4_5g28270 FvH4_5g28270 FvH4_5g28270
malus_domestica	MD08G1243900.v1.1 MD15G1438100.v1.1
prunus_persica	Prupe.1G581200_v2.0.a1 Prupe.1G581200_v2.0.a1 Prupe.1G581200_v2.0.a1 Prupe.1G581200_v2.0.a1 Prupe.1G581200_v2.0.a1
pyrus_communis	pycom08g21160 pycom15g38620
rosa_chinensis	RchiOBHm_Chr7g0220511
rosa_laevigata	RLG00000002220
rosa_multiflora	Rmu_co8386287.1_g000001 Rmu_ssc0000189.1_g000046
rosa_roxburghii	Rroxscaffold_3G00239340
rosa_rugosa	Rorug07G0194100 Rorug07G0194200
rosa_samantha	Rh7AG335200 Rh7BG326300 Rh7CG352900 Rh7DG331900
rosa_wichuraiana	Rw7G028580

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	79
Acc36I	ACCTGC	1 cut(s)	41
AccB7I	CCANNNNNTGG	1 cut(s)	248
AccI	GTMKAC	1 cut(s)	185
AciI	CCGC	1 cut(s)	60
AclWI	GGATC	1 cut(s)	379
AcsI	RAATTY	1 cut(s)	295
AfiI	CCNNNNNNNGG	1 cut(s)	248
AflIII	ACRYGT	1 cut(s)	359
AgsI	TTSAA	2 cut(s)	110, 261
AjnI	CCWGG	1 cut(s)	281
AjuI	GAANNNNNNNTTGG	2 cut(s)	18, 50
AlwI	GGATC	1 cut(s)	379
AoxI	GGCC	1 cut(s)	279
ApoI	RAATTY	1 cut(s)	295
AspS9I	GGNCC	2 cut(s)	39, 251
AvaII	GGWCC	2 cut(s)	39, 251
BccI	CCATC	3 cut(s)	199, 242, 266
BciT130I	CCWGG	1 cut(s)	283
BfaI	CTAG	1 cut(s)	18
BfuAI	ACCTGC	1 cut(s)	41
BisI	GCNGC	1 cut(s)	60
BlsI	GCNGC	1 cut(s)	61
Bme1390I	CCNGG	1 cut(s)	283
Bme18I	GGWCC	2 cut(s)	39, 251
BmgT120I	GGNCC	2 cut(s)	39, 251
BmiI	GGNNCC	2 cut(s)	40, 253
BmrFI	CCNGG	1 cut(s)	283
BpuEI	CTTGAG	1 cut(s)	159
BsaJI	CCNNGG	1 cut(s)	282
BsaWI	WCCGGW	1 cut(s)	341
BsaXI	ACNNNNNCTCC	2 cut(s)	192, 222
Bsc4I	CCNNNNNNNGG	1 cut(s)	248
BseBI	CCWGG	1 cut(s)	283
BseDI	CCNNGG	1 cut(s)	282
BseGI	GGATG	2 cut(s)	210, 253
BseLI	CCNNNNNNNGG	1 cut(s)	248
BsgI	GTGCAG	1 cut(s)	69
BshFI	GGCC	1 cut(s)	281
BsiSI	CCGG	1 cut(s)	342
BslFI	GGGAC	2 cut(s)	52, 237
BslI	CCNNNNNNNGG	1 cut(s)	248
BsmFI	GGGAC	2 cut(s)	52, 237
BsmI	GAATGC	1 cut(s)	220
BsnI	GGCC	1 cut(s)	281
Bsp143I	GATC	4 cut(s)	88, 125, 159, 371
BspACI	CCGC	1 cut(s)	60
BspANI	GGCC	1 cut(s)	281
BspHI	TCATGA	2 cut(s)	83, 128
BspLI	GGNNCC	2 cut(s)	40, 253
BspMI	ACCTGC	1 cut(s)	41
BspPI	GGATC	1 cut(s)	379
BssECI	CCNNGG	1 cut(s)	282
BssMI	GATC	4 cut(s)	88, 125, 159, 371
Bst2UI	CCWGG	1 cut(s)	283
BstAPI	GCANNNNNTGC	1 cut(s)	56
BstDEI	CTNAG	1 cut(s)	78
BstF5I	GGATG	2 cut(s)	210, 253
BstKTI	GATC	4 cut(s)	91, 128, 162, 374
BstMBI	GATC	4 cut(s)	88, 125, 159, 371
BstMWI	GCNNNNNNNGC	2 cut(s)	56, 287
BstNI	CCWGG	1 cut(s)	283
BstNSI	RCATGY	1 cut(s)	363
BstSCI	CCNGG	1 cut(s)	281
BstX2I	RGATCY	1 cut(s)	371
BstYI	RGATCY	1 cut(s)	371
BsuRI	GGCC	1 cut(s)	281
BtsCI	GGATG	2 cut(s)	210, 253
BveI	ACCTGC	1 cut(s)	41
CciI	TCATGA	2 cut(s)	83, 128
Cfr13I	GGNCC	2 cut(s)	39, 251
CspCI	CAANNNNNGTGG	2 cut(s)	293, 328
CviAII	CATG	3 cut(s)	84, 129, 360
CviJI	RGCY	3 cut(s)	9, 106, 281
CviKI_1	RGCY	3 cut(s)	9, 106, 281
DdeI	CTNAG	1 cut(s)	78
DpnI	GATC	4 cut(s)	90, 127, 161, 373
DpnII	GATC	4 cut(s)	88, 125, 159, 371
DrdI	GACNNNNNNGTC	1 cut(s)	79
DseDI	GACNNNNNNGTC	1 cut(s)	79
Eco47I	GGWCC	2 cut(s)	39, 251
EcoRI	GAATTC	1 cut(s)	295
EcoRII	CCWGG	1 cut(s)	281
FaeI	CATG	3 cut(s)	87, 132, 363
FaiI	YATR	7 cut(s)	65, 85, 130, 155, 238, 361, 387
FaqI	GGGAC	2 cut(s)	52, 237
FatI	CATG	3 cut(s)	83, 128, 359
FblI	GTMKAC	1 cut(s)	185
Fnu4HI	GCNGC	1 cut(s)	60
FokI	GGATG	2 cut(s)	217, 260
Fsp4HI	GCNGC	1 cut(s)	60
FspBI	CTAG	1 cut(s)	18
GluI	GCNGC	1 cut(s)	60
HaeIII	GGCC	1 cut(s)	281
HapII	CCGG	1 cut(s)	342
Hin1II	CATG	3 cut(s)	87, 132, 363
HincII	GTYRAC	1 cut(s)	171
HindII	GTYRAC	1 cut(s)	171
HpaII	CCGG	1 cut(s)	342
Hpy166II	GTNNAC	3 cut(s)	171, 186, 347
Hpy188I	TCNGA	1 cut(s)	93
Hpy188III	TCNNGA	3 cut(s)	84, 129, 211
Hpy8I	GTNNAC	3 cut(s)	171, 186, 347
HpyAV	CCTTC	3 cut(s)	88, 277, 361
HpyCH4V	TGCA	4 cut(s)	50, 123, 218, 290
HpyF10VI	GCNNNNNNNGC	2 cut(s)	56, 287
HpyF3I	CTNAG	1 cut(s)	78
Hsp92II	CATG	3 cut(s)	87, 132, 363
Kzo9I	GATC	4 cut(s)	88, 125, 159, 371
LpnPI	CCDG	5 cut(s)	36, 196, 268, 295, 355
MaeI	CTAG	1 cut(s)	18
MalI	GATC	4 cut(s)	90, 127, 161, 373
MboI	GATC	4 cut(s)	88, 125, 159, 371
MflI	RGATCY	1 cut(s)	371
MluCI	AATT	1 cut(s)	295
MmeI	TCCRAC	2 cut(s)	266, 324
MnlI	CCTC	2 cut(s)	194, 218
MseI	TTAA	1 cut(s)	413
MslI	CAYNNNNRTG	1 cut(s)	178
MspI	CCGG	1 cut(s)	342
MspR9I	CCNGG	1 cut(s)	283
Mva1269I	GAATGC	1 cut(s)	220
MvaI	CCWGG	1 cut(s)	283
MwoI	GCNNNNNNNGC	2 cut(s)	56, 287
NdeII	GATC	4 cut(s)	88, 125, 159, 371
NlaIII	CATG	3 cut(s)	87, 132, 363
NlaIV	GGNNCC	2 cut(s)	40, 253
NspI	RCATGY	1 cut(s)	363
PagI	TCATGA	2 cut(s)	83, 128
PciI	ACATGT	1 cut(s)	359
PctI	GAATGC	1 cut(s)	220
PflMI	CCANNNNNTGG	1 cut(s)	248
PkrI	GCNGC	1 cut(s)	61
PscI	ACATGT	1 cut(s)	359
Psp6I	CCWGG	1 cut(s)	281
PspGI	CCWGG	1 cut(s)	281
PspN4I	GGNNCC	2 cut(s)	40, 253
PspPI	GGNCC	2 cut(s)	39, 251
PsuI	RGATCY	1 cut(s)	371
RseI	CAYNNNNRTG	1 cut(s)	178
SaqAI	TTAA	1 cut(s)	413
SatI	GCNGC	1 cut(s)	60
Sau3AI	GATC	4 cut(s)	88, 125, 159, 371
Sau96I	GGNCC	2 cut(s)	39, 251
ScrFI	CCNGG	1 cut(s)	283
SetI	ASST	2 cut(s)	55, 170
SinI	GGWCC	2 cut(s)	39, 251
SmiMI	CAYNNNNRTG	1 cut(s)	178
SmlI	CTYRAG	1 cut(s)	138
SmoI	CTYRAG	1 cut(s)	138
Sse9I	AATT	1 cut(s)	295
SsiI	CCGC	1 cut(s)	60
SspMI	CTAG	1 cut(s)	18
StyD4I	CCNGG	1 cut(s)	281
TaqI	TCGA	1 cut(s)	270
TasI	AATT	1 cut(s)	295
TauI	GCSGC	1 cut(s)	62
Tru1I	TTAA	1 cut(s)	413
Tru9I	TTAA	1 cut(s)	413
TspDTI	ATGAA	1 cut(s)	145
TspGWI	ACGGA	1 cut(s)	260
Van91I	CCANNNNNTGG	1 cut(s)	248
VpaK11BI	GGWCC	2 cut(s)	39, 251
XapI	RAATTY	1 cut(s)	295
XceI	RCATGY	1 cut(s)	363
XmiI	GTMKAC	1 cut(s)	185
XspI	CTAG	1 cut(s)	18

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.