Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8400115.1

Orthogroup ID

OG0003748

Physical Location & Seq

Genomic Coordinates Reverse (-)

265 .. 1263

Gene Structure 999 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8400115.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 999 bp

atgtttggtgccattgacgaactttttgccaagacatctgtaaaacccaaggacattggaatattgattgtcaactgcagtttgttcaatccaactccgtctctttctgccatggttattaaccattaccagcttcgagggaacatagtcagctacaatcttggtggaatgggatgcagcgcaggtctcatctcaattgatcttgctcaaaagcttcttcaggtgcatcctaactcttatgcgctggttatcagcatggagaacatcacattgaactggtactttgggaatgatcgctcaaagcttgtttcaaattgcttatttcggatgggaggggctgctatacttctttcaaacaaaagctcagacagaagaaggtccaaataccggttggttcaaactgtccgcacacacaagggtgctgatgacaagtgctttagctgtgttacccaagaagaagatgatgctgggaagattggtgttactctatcaaaggacctgatggctgtagcaggtgatgctttgaagaccaatatcaccacattggggcctcttgttcttccaatgtccgagcagctgcttttctttgctacattggtgggtaggaaactcttcaagatgaagatcaaaccttacatcccagatttcagacttgcttttgagcatttctgcattcatgctggaggaagagccgtcttggatgaattagagaagaacctgcatctatctgattggcatatggagccatcaaggatgacactttaccgatttggaaacacctcaagcagttctctctggtatgagttggcttacacagaagcaaagggaaggatcaagaaaggagatagaacatggcagatagcttttgggtcgggattcaagtgtaatagtgctgtgtggaaagctctcaagagcatagatcctgcaaaggaaaagagcccatggatggctgaaattgatcagttcccagtcgatgttccaagggtgtcaaccttctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0006950 GO:0008150 GO:0009266 GO:0009314 GO:0009409 GO:0009416 GO:0009628 GO:0050896

KEGG Pathways

Metabolic & Signaling

ko00062 ko01110 map00062 map01110

Pfam Domains

Protein Families

ACP_syn_III_C FAE1_CUT1_RppA

Protein Analysis

332

Amino Acids

37.06

Weight (kDa)

9.2

Isoelectric Point (pI)

32.48

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003748)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G26640
fragaria_vesca	FvH4_1g04020 FvH4_2g29750 FvH4_2g29750
malus_domestica	MD00G1025800.v1.1 MD15G1118900.v1.1 MD15G1178600.v1.1
prunus_persica	Prupe.1G472100_v2.0.a1 Prupe.1G472100_v2.0.a1 Prupe.7G236700_v2.0.a1
pyrus_communis	pycom15g10700 pycom15g16040
rosa_chinensis	RchiOBHm_Chr2g0089491 RchiOBHm_Chr6g0298771
rosa_laevigata	RLG00000011487 RLG00000016035
rosa_multiflora	Rmu_co8400115.1_g000001 Rmu_sc0000197.1_g000003 Rmu_ssc0000397.1_g000013
rosa_roxburghii	Rroxscaffold_2G00151880 Rroxscaffold_7G00169350
rosa_rugosa	Rorug02G0001200 Rorug06G0282800 Rorug06G0282900
rosa_samantha	Rh2AG046500 Rh2BG045100 Rh2CG046900 Rh2DG046500 Rh6AG394300 Rh6BG402100 Rh6CG408000 Rh6DG394600
rosa_wichuraiana	Rw2G003610 Rw6G034490

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	503
Acc36I	ACCTGC	3 cut(s)	173, 503, 726
AccB1I	GGYRCC	1 cut(s)	8
AciI	CCGC	1 cut(s)	406
AclWI	GGATC	2 cut(s)	839, 914
AcuI	CTGAAG	1 cut(s)	203
AfaI	GTAC	1 cut(s)	281
AfiI	CCNNNNNNNGG	3 cut(s)	387, 546, 946
AgeI	ACCGGT	1 cut(s)	387
AgsI	TTSAA	8 cut(s)	88, 274, 312, 354, 398, 526, 616, 880
AleI	CACNNNNGTG	1 cut(s)	417
AluBI	AGCT	9 cut(s)	133, 153, 214, 304, 363, 441, 577, 863, 905
AluI	AGCT	9 cut(s)	133, 153, 214, 304, 363, 441, 577, 863, 905
Alw26I	GTCTC	2 cut(s)	105, 191
AlwI	GGATC	2 cut(s)	839, 914
AoxI	GGCC	1 cut(s)	548
ApeKI	GCWGC	4 cut(s)	177, 338, 574, 577
ArsI	GACNNNNNNTTYG	2 cut(s)	8, 40
AsiGI	ACCGGT	1 cut(s)	387
Asp700I	GAANNNNTTC	1 cut(s)	611
AspLEI	GCGC	2 cut(s)	182, 244
AspS9I	GGNCC	3 cut(s)	378, 496, 548
AsuHPI	GGTGA	2 cut(s)	527, 529
AvaII	GGWCC	2 cut(s)	378, 496
BanI	GGYRCC	1 cut(s)	8
BanII	GRGCYC	1 cut(s)	941
BbsI	GAAGAC	1 cut(s)	533
BbvI	GCAGC	4 cut(s)	189, 325, 564, 586
BccI	CCATC	4 cut(s)	322, 496, 754, 940
BceAI	ACGGC	1 cut(s)	677
BcgI	CGANNNNNNTGC	2 cut(s)	8, 42
BclI	TGATCA	1 cut(s)	958
BcoDI	GTCTC	2 cut(s)	105, 191
BfmI	CTRYAG	2 cut(s)	76, 507
BfuAI	ACCTGC	3 cut(s)	173, 503, 726
BisI	GCNGC	4 cut(s)	178, 339, 575, 578
BlsI	GCNGC	4 cut(s)	179, 340, 576, 579
Bme18I	GGWCC	2 cut(s)	378, 496
BmgT120I	GGNCC	3 cut(s)	378, 496, 548
BmiI	GGNNCC	3 cut(s)	10, 549, 744
BmrI	ACTGGG	1 cut(s)	962
BmsI	GCATC	5 cut(s)	164, 235, 454, 508, 730
BmuI	ACTGGG	1 cut(s)	962
BpiI	GAAGAC	1 cut(s)	533
BpmI	CTGGAG	1 cut(s)	702
BpuEI	CTTGAG	2 cut(s)	766, 893
BsaBI	GATNNNNATC	1 cut(s)	623
BsaI	GGTCTC	1 cut(s)	191
BsaJI	CCNNGG	4 cut(s)	48, 111, 941, 980
BsaWI	WCCGGW	1 cut(s)	387
Bsc4I	CCNNNNNNNGG	3 cut(s)	387, 546, 946
Bse118I	RCCGGY	1 cut(s)	387
Bse1I	ACTGG	2 cut(s)	281, 968
Bse8I	GATNNNNATC	1 cut(s)	623
BseDI	CCNNGG	4 cut(s)	48, 111, 941, 980
BseGI	GGATG	7 cut(s)	179, 226, 333, 636, 706, 759, 951
BseJI	GATNNNNATC	1 cut(s)	623
BseLI	CCNNNNNNNGG	3 cut(s)	387, 546, 946
BseMII	CTCAG	1 cut(s)	378
BseNI	ACTGG	2 cut(s)	281, 968
BseXI	GCAGC	4 cut(s)	189, 325, 564, 586
BseYI	CCCAGC	1 cut(s)	467
BshFI	GGCC	1 cut(s)	550
BshNI	GGYRCC	1 cut(s)	8
BshTI	ACCGGT	1 cut(s)	387
BsiSI	CCGG	1 cut(s)	388
BslI	CCNNNNNNNGG	3 cut(s)	387, 546, 946
BsmAI	GTCTC	2 cut(s)	105, 191
BsmBI	CGTCTC	1 cut(s)	105
BsmI	GAATGC	1 cut(s)	672
BsnI	GGCC	1 cut(s)	550
Bso31I	GGTCTC	1 cut(s)	191
Bsp1286I	GDGCHC	1 cut(s)	941
Bsp143I	GATC	6 cut(s)	199, 292, 624, 831, 919, 958
Bsp19I	CCATGG	2 cut(s)	111, 941
BspACI	CCGC	1 cut(s)	406
BspANI	GGCC	1 cut(s)	550
BspCNI	CTCAG	1 cut(s)	377
BspLI	GGNNCC	3 cut(s)	10, 549, 744
BspMAI	CTGCAG	1 cut(s)	80
BspMI	ACCTGC	3 cut(s)	173, 503, 726
BspPI	GGATC	2 cut(s)	839, 914
BspQI	GCTCTTC	1 cut(s)	682
BspT107I	GGYRCC	1 cut(s)	8
BspTNI	GGTCTC	1 cut(s)	191
BsrFI	RCCGGY	1 cut(s)	387
BsrI	ACTGG	2 cut(s)	281, 968
BssAI	RCCGGY	1 cut(s)	387
BssECI	CCNNGG	4 cut(s)	48, 111, 941, 980
BssMI	GATC	6 cut(s)	199, 292, 624, 831, 919, 958
BssT1I	CCWWGG	4 cut(s)	48, 111, 941, 980
Bst4CI	ACNGT	1 cut(s)	403
Bst6I	CTCTTC	2 cut(s)	617, 682
BstAPI	GCANNNNNTGC	1 cut(s)	518
BstDEI	CTNAG	1 cut(s)	364
BstDSI	CCRYGG	2 cut(s)	111, 941
BstF5I	GGATG	7 cut(s)	179, 226, 333, 636, 706, 759, 951
BstHHI	GCGC	2 cut(s)	182, 244
BstKTI	GATC	6 cut(s)	202, 295, 627, 834, 922, 961
BstMAI	GTCTC	2 cut(s)	105, 191
BstMBI	GATC	6 cut(s)	199, 292, 624, 831, 919, 958
BstMWI	GCNNNNNNNGC	2 cut(s)	518, 742
BstSFI	CTRYAG	2 cut(s)	76, 507
BstV1I	GCAGC	4 cut(s)	189, 325, 564, 586
BstV2I	GAAGAC	1 cut(s)	533
BstX2I	RGATCY	1 cut(s)	919
BstYI	RGATCY	1 cut(s)	919
BsuRI	GGCC	1 cut(s)	550
BtgI	CCRYGG	2 cut(s)	111, 941
BtsCI	GGATG	7 cut(s)	179, 226, 333, 636, 706, 759, 951
BveI	ACCTGC	3 cut(s)	173, 503, 726
CfoI	GCGC	2 cut(s)	182, 244
Cfr10I	RCCGGY	1 cut(s)	387
Cfr13I	GGNCC	3 cut(s)	378, 496, 548
Csp6I	GTAC	1 cut(s)	280
CspAI	ACCGGT	1 cut(s)	387
CspCI	CAANNNNNGTGG	2 cut(s)	145, 180
CviAII	CATG	5 cut(s)	112, 256, 677, 852, 942
CviQI	GTAC	1 cut(s)	280
DdeI	CTNAG	1 cut(s)	364
DpnI	GATC	6 cut(s)	201, 294, 626, 833, 921, 960
DpnII	GATC	6 cut(s)	199, 292, 624, 831, 919, 958
Eam1104I	CTCTTC	2 cut(s)	617, 682
EarI	CTCTTC	2 cut(s)	617, 682
Eco130I	CCWWGG	4 cut(s)	48, 111, 941, 980
Eco24I	GRGCYC	1 cut(s)	941
Eco31I	GGTCTC	1 cut(s)	191
Eco47I	GGWCC	2 cut(s)	378, 496
Eco57I	CTGAAG	1 cut(s)	203
EcoO109I	RGGNCCY	2 cut(s)	496, 548
EcoT14I	CCWWGG	4 cut(s)	48, 111, 941, 980
EcoT38I	GRGCYC	1 cut(s)	941
ErhI	CCWWGG	4 cut(s)	48, 111, 941, 980
Esp3I	CGTCTC	1 cut(s)	105
FaeI	CATG	5 cut(s)	115, 259, 680, 855, 945
FatI	CATG	5 cut(s)	111, 255, 676, 851, 941
FauNDI	CATATG	1 cut(s)	738
FbaI	TGATCA	1 cut(s)	958
Fnu4HI	GCNGC	4 cut(s)	178, 339, 575, 578
FokI	GGATG	7 cut(s)	186, 213, 340, 623, 713, 766, 958
FriOI	GRGCYC	1 cut(s)	941
Fsp4HI	GCNGC	4 cut(s)	178, 339, 575, 578
GlaI	GCGC	2 cut(s)	181, 243
GluI	GCNGC	4 cut(s)	178, 339, 575, 578
GsaI	CCCAGC	1 cut(s)	471
GsuI	CTGGAG	1 cut(s)	702
HaeIII	GGCC	1 cut(s)	550
HapII	CCGG	1 cut(s)	388
HhaI	GCGC	2 cut(s)	182, 244
Hin1II	CATG	5 cut(s)	115, 259, 680, 855, 945
Hin6I	GCGC	2 cut(s)	180, 242
HinP1I	GCGC	2 cut(s)	180, 242
HincII	GTYRAC	2 cut(s)	73, 990
HindII	GTYRAC	2 cut(s)	73, 990
HindIII	AAGCTT	2 cut(s)	212, 302
HinfI	GANTC	1 cut(s)	876
HpaII	CCGG	1 cut(s)	388
HphI	GGTGA	2 cut(s)	527, 529
Hpy166II	GTNNAC	2 cut(s)	73, 990
Hpy188I	TCNGA	5 cut(s)	327, 367, 571, 650, 730
Hpy188III	TCNNGA	4 cut(s)	616, 835, 873, 910
Hpy8I	GTNNAC	2 cut(s)	73, 990
HpyAV	CCTTC	2 cut(s)	369, 822
HpyCH4III	ACNGT	1 cut(s)	403
HpyCH4V	TGCA	6 cut(s)	78, 177, 226, 672, 721, 926
HpyF10VI	GCNNNNNNNGC	2 cut(s)	518, 742
HpyF3I	CTNAG	1 cut(s)	364
Hsp92II	CATG	5 cut(s)	115, 259, 680, 855, 945
HspAI	GCGC	2 cut(s)	180, 242
Ksp22I	TGATCA	1 cut(s)	958
Kzo9I	GATC	6 cut(s)	199, 292, 624, 831, 919, 958
LguI	GCTCTTC	1 cut(s)	682
LmnI	GCTCC	1 cut(s)	742
Lsp1109I	GCAGC	4 cut(s)	189, 325, 564, 586
LweI	GCATC	5 cut(s)	164, 235, 454, 508, 730
MaeIII	GTNAC	2 cut(s)	445, 481
MalI	GATC	6 cut(s)	201, 294, 626, 833, 921, 960
MboI	GATC	6 cut(s)	199, 292, 624, 831, 919, 958
MfeI	CAATTG	1 cut(s)	195
MflI	RGATCY	1 cut(s)	919
MhlI	GDGCHC	1 cut(s)	941
MluCI	AATT	4 cut(s)	195, 313, 704, 954
MmeI	TCCRAC	1 cut(s)	116
MnlI	CCTC	5 cut(s)	131, 326, 561, 677, 790
MroXI	GAANNNNTTC	1 cut(s)	611
MseI	TTAA	1 cut(s)	120
MslI	CAYNNNNRTG	1 cut(s)	417
MspA1I	CMGCKG	1 cut(s)	577
MspI	CCGG	1 cut(s)	388
MunI	CAATTG	1 cut(s)	195
Mva1269I	GAATGC	1 cut(s)	672
MwoI	GCNNNNNNNGC	2 cut(s)	518, 742
NcoI	CCATGG	2 cut(s)	111, 941
NdeI	CATATG	1 cut(s)	738
NdeII	GATC	6 cut(s)	199, 292, 624, 831, 919, 958
NlaIII	CATG	5 cut(s)	115, 259, 680, 855, 945
NlaIV	GGNNCC	3 cut(s)	10, 549, 744
OliI	CACNNNNGTG	1 cut(s)	417
PaqCI	CACCTGC	1 cut(s)	503
PciSI	GCTCTTC	1 cut(s)	682
PctI	GAATGC	1 cut(s)	672
PdmI	GAANNNNTTC	1 cut(s)	611
PfeI	GAWTC	1 cut(s)	876
PinAI	ACCGGT	1 cut(s)	387
PkrI	GCNGC	4 cut(s)	179, 340, 576, 579
PpuMI	RGGWCCY	1 cut(s)	496
Psp5II	RGGWCCY	1 cut(s)	496
PspFI	CCCAGC	1 cut(s)	467
PspN4I	GGNNCC	3 cut(s)	10, 549, 744
PspPI	GGNCC	3 cut(s)	378, 496, 548
PspPPI	RGGWCCY	1 cut(s)	496
PstI	CTGCAG	1 cut(s)	80
PsuI	RGATCY	1 cut(s)	919
PvuII	CAGCTG	1 cut(s)	577
RsaI	GTAC	1 cut(s)	281
RsaNI	GTAC	1 cut(s)	280
RseI	CAYNNNNRTG	1 cut(s)	417
SapI	GCTCTTC	1 cut(s)	682
SaqAI	TTAA	1 cut(s)	120
SatI	GCNGC	4 cut(s)	178, 339, 575, 578
Sau3AI	GATC	6 cut(s)	199, 292, 624, 831, 919, 958
Sau96I	GGNCC	3 cut(s)	378, 496, 548
SduI	GDGCHC	1 cut(s)	941
SfaNI	GCATC	5 cut(s)	164, 235, 454, 508, 730
SfcI	CTRYAG	2 cut(s)	76, 507
SinI	GGWCC	2 cut(s)	378, 496
SmiMI	CAYNNNNRTG	1 cut(s)	417
SmlI	CTYRAG	2 cut(s)	781, 908
SmoI	CTYRAG	2 cut(s)	781, 908
Sse9I	AATT	4 cut(s)	195, 313, 704, 954
SsiI	CCGC	1 cut(s)	406
SspI	AATATT	1 cut(s)	63
StyI	CCWWGG	4 cut(s)	48, 111, 941, 980
TaaI	ACNGT	1 cut(s)	403
TaqI	TCGA	2 cut(s)	136, 972
TasI	AATT	4 cut(s)	195, 313, 704, 954
TfiI	GAWTC	1 cut(s)	876
Tru1I	TTAA	1 cut(s)	120
Tru9I	TTAA	1 cut(s)	120
TseI	GCWGC	4 cut(s)	177, 338, 574, 577
TspDTI	ATGAA	3 cut(s)	635, 665, 717
TspGWI	ACGGA	1 cut(s)	87
VpaK11BI	GGWCC	2 cut(s)	378, 496
XcmI	CCANNNNNNNNNTGG	1 cut(s)	388
XmnI	GAANNNNTTC	1 cut(s)	611

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.