Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8411067.1

Orthogroup ID

OG0002992

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1293

Gene Structure 1293 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8411067.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 188 bp

atgattaatggttctccttgggttggccagcaccctaaccatgagaatgcacgatgcttcatgctagtacatacggatgggacgattgaagatgtttcgtaccacaagtgcatcattggtgcttttgatatcatagctcctcatagggcaaagggctatcgcctgagacatttgagccgtggtcctcg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000418 GO:0000428 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005666 GO:0006139 GO:0006396 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009892 GO:0009987 GO:0010033 GO:0010467 GO:0010468 GO:0010495 GO:0010605 GO:0010608 GO:0010629 GO:0014070 GO:0016070 GO:0016246 GO:0016441 GO:0016458 GO:0019222 GO:0030422 GO:0030880 GO:0031047 GO:0031050 GO:0031974 GO:0031981 GO:0032991 GO:0034641 GO:0035194 GO:0040029 GO:0042221 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043331 GO:0044237 GO:0044238 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044451 GO:0044464 GO:0046483 GO:0048519 GO:0050789 GO:0050896 GO:0051716 GO:0055029 GO:0060255 GO:0061695 GO:0065007 GO:0070013 GO:0070887 GO:0070918 GO:0071310 GO:0071359 GO:0071407 GO:0071704 GO:0090304 GO:1901360 GO:1901698 GO:1901699 GO:1902494 GO:1990234

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF3223 RNA_pol_Rpb1_1 RNA_pol_Rpb1_2 RNA_pol_Rpb1_3 RNA_pol_Rpb1_4 RNA_pol_Rpb1_5

Protein Analysis

63

Amino Acids

7.18

Weight (kDa)

9.3

Isoelectric Point (pI)

28.94

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002992)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G63020 AT1G63020 AT1G63020 AT1G63020 AT1G63020
fragaria_vesca	FvH4_5g01400 FvH4_5g01400 FvH4_5g01400 FvH4_5g01400 FvH4_5g01400 FvH4_5g01400 FvH4_5g01400 FvH4_5g01400 FvH4_5g01400 FvH4_5g01400 FvH4_5g01400 FvH4_5g01400
malus_domestica	MD04G1068800.v1.1 MD06G1069300.v1.1 MD06G1069400.v1.1 MD06G1069500.v1.1 MD06G1069800.v1.1
prunus_persica	Prupe.5G089300_v2.0.a1
pyrus_communis	pycom04g06250
rosa_chinensis	RchiOBHm_Chr7g0199481
rosa_laevigata	RLG00000003790
rosa_multiflora	Rmu_co8411067.1_g000001 Rmu_sc0003890.1_g000001
rosa_roxburghii	Rroxscaffold_3G00256700
rosa_rugosa	Rorug07G0054300 Rorug07G0054400 Rorug07G0054500 Rorug07G0054500
rosa_samantha	Rh7AG179300 Rh7BG182800 Rh7CG188100 Rh7DG182200
rosa_wichuraiana	Rw7G015760

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	25
AfaI	GTAC	2 cut(s)	69, 101
AfiI	CCNNNNNNNGG	1 cut(s)	23
AgsI	TTSAA	1 cut(s)	89
AluBI	AGCT	1 cut(s)	137
AluI	AGCT	1 cut(s)	137
Alw26I	GTCTC	1 cut(s)	160
AoxI	GGCC	1 cut(s)	25
AseI	ATTAAT	1 cut(s)	6
AspS9I	GGNCC	1 cut(s)	182
AvaII	GGWCC	1 cut(s)	182
BalI	TGGCCA	1 cut(s)	27
BccI	CCATC	1 cut(s)	71
BceAI	ACGGC	1 cut(s)	162
BcoDI	GTCTC	1 cut(s)	160
BfaI	CTAG	1 cut(s)	65
Bme18I	GGWCC	1 cut(s)	182
BmgT120I	GGNCC	1 cut(s)	182
BmsI	GCATC	2 cut(s)	44, 120
BsaJI	CCNNGG	2 cut(s)	17, 178
Bsc4I	CCNNNNNNNGG	1 cut(s)	23
BseDI	CCNNGG	2 cut(s)	17, 178
BseGI	GGATG	1 cut(s)	82
BseLI	CCNNNNNNNGG	1 cut(s)	23
BseMII	CTCAG	1 cut(s)	155
BseRI	GAGGAG	1 cut(s)	129
BshFI	GGCC	1 cut(s)	27
BslFI	GGGAC	1 cut(s)	94
BslI	CCNNNNNNNGG	1 cut(s)	23
BsmAI	GTCTC	1 cut(s)	160
BsmFI	GGGAC	1 cut(s)	94
BsmI	GAATGC	1 cut(s)	52
BsnI	GGCC	1 cut(s)	27
BspANI	GGCC	1 cut(s)	27
BspCNI	CTCAG	1 cut(s)	156
BssECI	CCNNGG	2 cut(s)	17, 178
BssT1I	CCWWGG	1 cut(s)	17
BstC8I	GCNNGC	1 cut(s)	29
BstDEI	CTNAG	1 cut(s)	164
BstDSI	CCRYGG	1 cut(s)	178
BstF5I	GGATG	1 cut(s)	82
BstMAI	GTCTC	1 cut(s)	160
BsuRI	GGCC	1 cut(s)	27
BtgI	CCRYGG	1 cut(s)	178
BtsCI	GGATG	1 cut(s)	82
Cac8I	GCNNGC	1 cut(s)	29
Cfr13I	GGNCC	1 cut(s)	182
Csp6I	GTAC	2 cut(s)	68, 100
CviAII	CATG	2 cut(s)	41, 61
CviJI	RGCY	4 cut(s)	27, 137, 156, 177
CviKI_1	RGCY	4 cut(s)	27, 137, 156, 177
CviQI	GTAC	2 cut(s)	68, 100
DdeI	CTNAG	1 cut(s)	164
EaeI	YGGCCR	1 cut(s)	25
Eco130I	CCWWGG	1 cut(s)	17
Eco32I	GATATC	1 cut(s)	130
Eco47I	GGWCC	1 cut(s)	182
EcoRV	GATATC	1 cut(s)	130
EcoT14I	CCWWGG	1 cut(s)	17
ErhI	CCWWGG	1 cut(s)	17
FaeI	CATG	2 cut(s)	44, 64
FaiI	YATR	5 cut(s)	42, 62, 72, 134, 144
FaqI	GGGAC	1 cut(s)	94
FatI	CATG	2 cut(s)	40, 60
FokI	GGATG	1 cut(s)	89
FspBI	CTAG	1 cut(s)	65
HaeIII	GGCC	1 cut(s)	27
Hin1II	CATG	2 cut(s)	44, 64
HpyCH4V	TGCA	2 cut(s)	50, 111
HpyF3I	CTNAG	1 cut(s)	164
Hsp92II	CATG	2 cut(s)	44, 64
LmnI	GCTCC	1 cut(s)	142
LpnPI	CCDG	2 cut(s)	41, 176
LweI	GCATC	2 cut(s)	44, 120
MaeI	CTAG	1 cut(s)	65
MboII	GAAGA	1 cut(s)	101
MlsI	TGGCCA	1 cut(s)	27
MluNI	TGGCCA	1 cut(s)	27
MnlI	CCTC	1 cut(s)	150
Mox20I	TGGCCA	1 cut(s)	27
MscI	TGGCCA	1 cut(s)	27
MseI	TTAA	1 cut(s)	6
MslI	CAYNNNNRTG	2 cut(s)	45, 75
Msp20I	TGGCCA	1 cut(s)	27
Mva1269I	GAATGC	1 cut(s)	52
NlaIII	CATG	2 cut(s)	44, 64
PcsI	WCGNNNNNNNCGW	1 cut(s)	80
PctI	GAATGC	1 cut(s)	52
PshBI	ATTAAT	1 cut(s)	6
PspPI	GGNCC	1 cut(s)	182
RsaI	GTAC	2 cut(s)	69, 101
RsaNI	GTAC	2 cut(s)	68, 100
RseI	CAYNNNNRTG	2 cut(s)	45, 75
SaqAI	TTAA	1 cut(s)	6
Sau96I	GGNCC	1 cut(s)	182
SetI	ASST	1 cut(s)	139
SfaNI	GCATC	2 cut(s)	44, 120
SgeI	CNNG	8 cut(s)	30, 40, 53, 63, 73, 77, 118, 175
SinI	GGWCC	1 cut(s)	182
SmiMI	CAYNNNNRTG	2 cut(s)	45, 75
SspMI	CTAG	1 cut(s)	65
StyI	CCWWGG	1 cut(s)	17
TatI	WGTACW	1 cut(s)	67
Tru1I	TTAA	1 cut(s)	6
Tru9I	TTAA	1 cut(s)	6
TspDTI	ATGAA	1 cut(s)	49
TspGWI	ACGGA	1 cut(s)	89
VpaK11BI	GGWCC	1 cut(s)	182
VspI	ATTAAT	1 cut(s)	6
XspI	CTAG	1 cut(s)	65

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.